EMAIL THIS PAGE TO A FRIEND

FAT4

FAT atypical cadherin 4

62 Gene Product Result for
Synonyms: CDHF14 CDHR11 FAT-J FATJ NBLA00548
UniProtKB ID: Q6V0I7, A8K5Z6, B5MDG4, Q3LIA6, Q8TCK7, Q9H5T6
Gene ID:
Mouse(329628) FAT tumor suppressor homolog 4 (Drosophila)
Rat(310341) FAT atypical cadherin 4
Zebrafish(100332759) FAT tumor suppressor homolog 4 (Drosophila)
chicken(395166) FAT tumor suppressor homolog 4 (Drosophila)
cow(781683) FAT atypical cadherin 4
Horse(100063659) FAT tumor suppressor homolog 4 (Drosophila)
domestic cat(101085714) FAT tumor suppressor homolog 4 (Drosophila)
dog(483834) FAT tumor suppressor homolog 4 (Drosophila)
sheep(101123237) FAT tumor suppressor homolog 4 (Drosophila)
naked mole-rat(101696655) FAT atypical cadherin 4
domestic guinea pig(100722846) FAT atypical cadherin 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_183221 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_183221 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_183221 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024582 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024582 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024582 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024582 Rosetta Predictions human pricing
XM_001070073 Rosetta Predictions rat pricing
XM_227060 Rosetta Predictions rat pricing
NM_183221 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024582 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00356911 predicted 3691
2 SASI_Hs01_00089940 predicted 14166
3 SASI_Hs02_00356912 predicted 4068
4 SASI_Hs02_00356913 predicted 1683
5 SASI_Hs02_00356914 predicted 4549
6 SASI_Hs01_00089946 predicted 7207
7 SASI_Hs01_00089947 predicted 7499
8 SASI_Hs01_00089949 predicted 6659
9 SASI_Hs02_00356915 predicted 2417
10 SASI_Hs02_00356916 predicted 6240
11 SASI_Hs01_00089941 predicted 847
12 SASI_Hs01_00089942 predicted 4829
13 SASI_Hs01_00089943 predicted 3059
14 SASI_Hs01_00089944 predicted 9387
15 SASI_Hs01_00089945 predicted 3904
16 SASI_Hs01_00089948 predicted 6790
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001070073 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00330347 predicted 12280
2 SASI_Rn02_00330348 predicted 5804
3 SASI_Rn02_00330349 predicted 13784
4 SASI_Rn02_00330350 predicted 9770
5 SASI_Rn02_00330351 predicted 5325
6 SASI_Rn02_00330352 predicted 3103
7 SASI_Rn02_00330353 predicted 1068
8 SASI_Rn02_00330354 predicted 8617
9 SASI_Rn02_00330355 predicted 9930
10 SASI_Rn02_00330356 predicted 4384
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_227060 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00384041 predicted 12273
2 SASI_Rn02_00384042 predicted 5801
3 SASI_Rn02_00384043 predicted 9774
4 SASI_Rn02_00384044 predicted 5327
5 SASI_Rn02_00384045 predicted 3103
6 SASI_Rn02_00384046 predicted 1062
7 SASI_Rn02_00384047 predicted 8623
8 SASI_Rn02_00384048 predicted 9931
9 SASI_Rn02_00384049 predicted 1971
10 SASI_Rn02_00384050 predicted 4383
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183221 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00123042 predicted 10682
2 SASI_Mm01_00123043 predicted 12278
3 SASI_Mm02_00350319 predicted 10085
4 SASI_Mm01_00123044 predicted 10580
5 SASI_Mm01_00123045 predicted 5804
6 SASI_Mm01_00123046 predicted 3487
7 SASI_Mm01_00123047 predicted 6874
8 SASI_Mm01_00123048 predicted 1972
9 SASI_Mm02_00350320 predicted 2658
10 SASI_Mm01_00123049 predicted 4802
11 SASI_Mm01_00123050 predicted 2297
12 SASI_Mm01_00123051 predicted 6266
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183221
FAT4 MISSION shRNA Bacterial Glycerol Stock
FAT atypical cadherin 4
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000192780    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183221.1-1030s1c1
Sequence:CCGGCCTCTTCTGAAGAAGACTGTACTCGAGTACAGTCTTCTTCAGAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192604    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183221.1-1193s1c1
Sequence:CCGGGCCCAAGTTATCTCAAGTCAACTCGAGTTGACTTGAGATAACTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192086    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183221.1-1220s1c1
Sequence:CCGGCGATGCAGATGACGAAGATAACTCGAGTTATCTTCGTCATCTGCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183221.3-7500s21c1
Sequence:CCGGGACGCGGACATAGGATCTAATCTCGAGATTAGATCCTATGTCCGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183221.3-3916s21c1
Sequence:CCGGGCACCCTGAGTATCGATATTTCTCGAGAAATATCGATACTCAGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183221.3-6877s21c1
Sequence:CCGGACGATGATCAAGGTCCAAATACTCGAGTATTTGGACCTTGATCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183221.3-8589s21c1
Sequence:CCGGAGTACCGATGTCACCATATTTCTCGAGAAATATGGTGACATCGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248881    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183221.3-15750s21c1
Sequence:CCGGGACCTATGCAGGCCCTAATTGCTCGAGCAATTAGGGCCTGCATAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183221
FAT4 MISSION shRNA shRNA Plasmid DNA
FAT atypical cadherin 4
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000192780    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183221.1-1030s1c1
Sequence:CCGGCCTCTTCTGAAGAAGACTGTACTCGAGTACAGTCTTCTTCAGAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192604    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183221.1-1193s1c1
Sequence:CCGGGCCCAAGTTATCTCAAGTCAACTCGAGTTGACTTGAGATAACTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192086    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183221.1-1220s1c1
Sequence:CCGGCGATGCAGATGACGAAGATAACTCGAGTTATCTTCGTCATCTGCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183221.3-7500s21c1
Sequence:CCGGGACGCGGACATAGGATCTAATCTCGAGATTAGATCCTATGTCCGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183221.3-3916s21c1
Sequence:CCGGGCACCCTGAGTATCGATATTTCTCGAGAAATATCGATACTCAGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183221.3-6877s21c1
Sequence:CCGGACGATGATCAAGGTCCAAATACTCGAGTATTTGGACCTTGATCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183221.3-8589s21c1
Sequence:CCGGAGTACCGATGTCACCATATTTCTCGAGAAATATGGTGACATCGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248881    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183221.3-15750s21c1
Sequence:CCGGGACCTATGCAGGCCCTAATTGCTCGAGCAATTAGGGCCTGCATAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183221
FAT4 MISSION shRNA Lentiviral Transduction Particles
FAT atypical cadherin 4
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000192780    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183221.1-1030s1c1
Sequence:CCGGCCTCTTCTGAAGAAGACTGTACTCGAGTACAGTCTTCTTCAGAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192604    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183221.1-1193s1c1
Sequence:CCGGGCCCAAGTTATCTCAAGTCAACTCGAGTTGACTTGAGATAACTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192086    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183221.1-1220s1c1
Sequence:CCGGCGATGCAGATGACGAAGATAACTCGAGTTATCTTCGTCATCTGCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183221.3-7500s21c1
Sequence:CCGGGACGCGGACATAGGATCTAATCTCGAGATTAGATCCTATGTCCGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183221.3-3916s21c1
Sequence:CCGGGCACCCTGAGTATCGATATTTCTCGAGAAATATCGATACTCAGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183221.3-6877s21c1
Sequence:CCGGACGATGATCAAGGTCCAAATACTCGAGTATTTGGACCTTGATCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183221.3-8589s21c1
Sequence:CCGGAGTACCGATGTCACCATATTTCTCGAGAAATATGGTGACATCGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248881    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183221.3-15750s21c1
Sequence:CCGGGACCTATGCAGGCCCTAATTGCTCGAGCAATTAGGGCCTGCATAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024582
VALIDATED
FAT4 MISSION shRNA Bacterial Glycerol Stock
FAT atypical cadherin 4
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000055983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_024582.2-2153s1c1
Sequence:CCGGGCGCATTGTTAGATAGGGAAACTCGAGTTTCCCTATCTAACAATGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024582.2-7339s1c1
Sequence:CCGGGCCTTATCATTAGAAGGCAAACTCGAGTTTGCCTTCTAATGATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024582.2-8398s1c1
Sequence:CCGGCCTGACAATATCCCTCCCTATCTCGAGATAGGGAGGGATATTGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024582.2-1363s1c1
Sequence:CCGGGCTTTGTATAAAGTGGAGATTCTCGAGAATCTCCACTTTATACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024582.2-9324s1c1
Sequence:CCGGGCCCAAATTATCTCAAGTCAACTCGAGTTGACTTGAGATAATTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024582
VALIDATED
FAT4 MISSION shRNA shRNA Plasmid DNA
FAT atypical cadherin 4
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000055983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_024582.2-2153s1c1
Sequence:CCGGGCGCATTGTTAGATAGGGAAACTCGAGTTTCCCTATCTAACAATGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024582.2-7339s1c1
Sequence:CCGGGCCTTATCATTAGAAGGCAAACTCGAGTTTGCCTTCTAATGATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024582.2-8398s1c1
Sequence:CCGGCCTGACAATATCCCTCCCTATCTCGAGATAGGGAGGGATATTGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024582.2-1363s1c1
Sequence:CCGGGCTTTGTATAAAGTGGAGATTCTCGAGAATCTCCACTTTATACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024582.2-9324s1c1
Sequence:CCGGGCCCAAATTATCTCAAGTCAACTCGAGTTGACTTGAGATAATTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024582
VALIDATED
FAT4 MISSION shRNA Lentiviral Transduction Particles
FAT atypical cadherin 4
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000055983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_024582.2-2153s1c1
Sequence:CCGGGCGCATTGTTAGATAGGGAAACTCGAGTTTCCCTATCTAACAATGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024582.2-7339s1c1
Sequence:CCGGGCCTTATCATTAGAAGGCAAACTCGAGTTTGCCTTCTAATGATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024582.2-8398s1c1
Sequence:CCGGCCTGACAATATCCCTCCCTATCTCGAGATAGGGAGGGATATTGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024582.2-1363s1c1
Sequence:CCGGGCTTTGTATAAAGTGGAGATTCTCGAGAATCTCCACTTTATACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024582.2-9324s1c1
Sequence:CCGGGCCCAAATTATCTCAAGTCAACTCGAGTTGACTTGAGATAATTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks