EMAIL THIS PAGE TO A FRIEND

FATE1

fetal and adult testis expressed 1

48 Gene Product Result for
Synonyms: CT43 FATE
UniProtKB ID: Q969F0
Gene ID:
Human(89885) Summary: This gene encodes a cancer-testis antigen that is highly expressed in hepatocellular carcinomas and other tumors and weakly expressed in normal tissues except testis. The protein is strongly expressed in spermatogonia, primary spermatocytes, and Sertoli cells in seminiferous tubules. This protein may have a role in the control of early testicular differentiation and cell proliferation. [provided by RefSeq, Jan 2010]
Mouse(77905) fetal and adult testis expressed 1
domestic cat(101099191) fetal and adult testis expressed 1
cow(281153) fetal and adult testis expressed 1
dog(481076) fetal and adult testis expressed 1
naked mole-rat(101713950) fetal and adult testis expressed 1
sheep(101114084) fetal and adult testis expressed 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033085 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033085 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033085 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_183127 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_183127 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_183127 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU131881 MISSION® esiRNA esiRNA human FATE1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033085 Rosetta Predictions human pricing
NM_183127 Rosetta Predictions mouse pricing
NR_003243 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033085 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00233271 predicted 330
2 SASI_Hs01_00233272 predicted 396
3 SASI_Hs01_00233273 predicted 740
4 SASI_Hs01_00233274 predicted 266
5 SASI_Hs01_00233276 predicted 259
6 SASI_Hs01_00233277 predicted 264
7 SASI_Hs01_00233278 predicted 272
8 SASI_Hs01_00233279 predicted 436
9 SASI_Hs01_00233280 predicted 612
10 SASI_Hs02_00360789 predicted 261
11 SASI_Hs01_00233275 predicted 452
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183127 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00103851 predicted 690
2 SASI_Mm01_00103852 predicted 656
3 SASI_Mm01_00103853 predicted 561
4 SASI_Mm01_00103854 predicted 712
5 SASI_Mm01_00103855 predicted 430
6 SASI_Mm01_00103856 predicted 210
7 SASI_Mm01_00103857 predicted 210
8 SASI_Mm01_00103858 predicted 431
9 SASI_Mm01_00103859 predicted 341
10 SASI_Mm01_00103860 predicted 449
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_003243 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00353174 predicted 684
2 SASI_Mm02_00353175 predicted 648
3 SASI_Mm02_00353176 predicted 555
4 SASI_Mm02_00353177 predicted 707
5 SASI_Mm02_00353178 predicted 426
6 SASI_Mm02_00353179 predicted 196
7 SASI_Mm02_00353180 predicted 591
8 SASI_Mm02_00353181 predicted 201
9 SASI_Mm02_00353182 predicted 429
10 SASI_Mm02_00353183 predicted 444
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033085
FATE1 MISSION shRNA Bacterial Glycerol Stock
fetal and adult testis expressed 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033085.2-272s1c1
Sequence:CCGGCAGCCAAACGAGTTTGGAATACTCGAGTATTCCAAACTCGTTTGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130083    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033085.2-188s1c1
Sequence:CCGGCAGAAATGATGGAGCTTGGATCTCGAGATCCAAGCTCCATCATTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033085.2-399s1c1
Sequence:CCGGCCAAGGCATACGTTTCCATTACTCGAGTAATGGAAACGTATGCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033085.2-190s1c1
Sequence:CCGGGAAATGATGGAGCTTGGATCTCTCGAGAGATCCAAGCTCCATCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149994    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033085.2-275s1c1
Sequence:CCGGCCAAACGAGTTTGGAATATGACTCGAGTCATATTCCAAACTCGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033085.2-393s1c1
Sequence:CCGGCAATTTCCAAGGCATACGTTTCTCGAGAAACGTATGCCTTGGAAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148301    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033085.2-400s1c1
Sequence:CCGGCAAGGCATACGTTTCCATTATCTCGAGATAATGGAAACGTATGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148436    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033085.2-130s1c1
Sequence:CCGGCTGGCAGAAGAACTGAATCATCTCGAGATGATTCAGTTCTTCTGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149911    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033085.2-281s1c1
Sequence:CCGGGAGTTTGGAATATGACTGCCACTCGAGTGGCAGTCATATTCCAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033085.2-133s1c1
Sequence:CCGGGCAGAAGAACTGAATCATGGACTCGAGTCCATGATTCAGTTCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033085
FATE1 MISSION shRNA shRNA Plasmid DNA
fetal and adult testis expressed 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033085.2-272s1c1
Sequence:CCGGCAGCCAAACGAGTTTGGAATACTCGAGTATTCCAAACTCGTTTGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130083    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033085.2-188s1c1
Sequence:CCGGCAGAAATGATGGAGCTTGGATCTCGAGATCCAAGCTCCATCATTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033085.2-399s1c1
Sequence:CCGGCCAAGGCATACGTTTCCATTACTCGAGTAATGGAAACGTATGCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033085.2-190s1c1
Sequence:CCGGGAAATGATGGAGCTTGGATCTCTCGAGAGATCCAAGCTCCATCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149994    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033085.2-275s1c1
Sequence:CCGGCCAAACGAGTTTGGAATATGACTCGAGTCATATTCCAAACTCGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033085.2-393s1c1
Sequence:CCGGCAATTTCCAAGGCATACGTTTCTCGAGAAACGTATGCCTTGGAAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148301    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033085.2-400s1c1
Sequence:CCGGCAAGGCATACGTTTCCATTATCTCGAGATAATGGAAACGTATGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148436    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033085.2-130s1c1
Sequence:CCGGCTGGCAGAAGAACTGAATCATCTCGAGATGATTCAGTTCTTCTGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149911    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033085.2-281s1c1
Sequence:CCGGGAGTTTGGAATATGACTGCCACTCGAGTGGCAGTCATATTCCAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033085.2-133s1c1
Sequence:CCGGGCAGAAGAACTGAATCATGGACTCGAGTCCATGATTCAGTTCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033085
FATE1 MISSION shRNA Lentiviral Transduction Particles
fetal and adult testis expressed 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033085.2-272s1c1
Sequence:CCGGCAGCCAAACGAGTTTGGAATACTCGAGTATTCCAAACTCGTTTGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130083    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033085.2-188s1c1
Sequence:CCGGCAGAAATGATGGAGCTTGGATCTCGAGATCCAAGCTCCATCATTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033085.2-399s1c1
Sequence:CCGGCCAAGGCATACGTTTCCATTACTCGAGTAATGGAAACGTATGCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033085.2-190s1c1
Sequence:CCGGGAAATGATGGAGCTTGGATCTCTCGAGAGATCCAAGCTCCATCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149994    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033085.2-275s1c1
Sequence:CCGGCCAAACGAGTTTGGAATATGACTCGAGTCATATTCCAAACTCGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033085.2-393s1c1
Sequence:CCGGCAATTTCCAAGGCATACGTTTCTCGAGAAACGTATGCCTTGGAAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148301    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033085.2-400s1c1
Sequence:CCGGCAAGGCATACGTTTCCATTATCTCGAGATAATGGAAACGTATGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148436    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033085.2-130s1c1
Sequence:CCGGCTGGCAGAAGAACTGAATCATCTCGAGATGATTCAGTTCTTCTGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149911    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033085.2-281s1c1
Sequence:CCGGGAGTTTGGAATATGACTGCCACTCGAGTGGCAGTCATATTCCAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033085.2-133s1c1
Sequence:CCGGGCAGAAGAACTGAATCATGGACTCGAGTCCATGATTCAGTTCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183127
FATE1 MISSION shRNA Bacterial Glycerol Stock
fetal and adult testis expressed 1
Mouse
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000189194    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_183127.1-771s1c1
Sequence:CCGGCCATGACAGAAACACCAGCATCTCGAGATGCTGGTGTTTCTGTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000187738    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183127.1-270s1c1
Sequence:CCGGGAGATTCCCTTATGAGTGTCTCTCGAGAGACACTCATAAGGGAATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000188611    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183127.1-229s1c1
Sequence:CCGGGATGTCCAGCTTCAGGAGTTTCTCGAGAAACTCCTGAAGCTGGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183127
FATE1 MISSION shRNA shRNA Plasmid DNA
fetal and adult testis expressed 1
Mouse
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000189194    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_183127.1-771s1c1
Sequence:CCGGCCATGACAGAAACACCAGCATCTCGAGATGCTGGTGTTTCTGTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000187738    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183127.1-270s1c1
Sequence:CCGGGAGATTCCCTTATGAGTGTCTCTCGAGAGACACTCATAAGGGAATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000188611    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183127.1-229s1c1
Sequence:CCGGGATGTCCAGCTTCAGGAGTTTCTCGAGAAACTCCTGAAGCTGGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183127
FATE1 MISSION shRNA Lentiviral Transduction Particles
fetal and adult testis expressed 1
Mouse
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000189194    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_183127.1-771s1c1
Sequence:CCGGCCATGACAGAAACACCAGCATCTCGAGATGCTGGTGTTTCTGTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000187738    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183127.1-270s1c1
Sequence:CCGGGAGATTCCCTTATGAGTGTCTCTCGAGAGACACTCATAAGGGAATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000188611    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183127.1-229s1c1
Sequence:CCGGGATGTCCAGCTTCAGGAGTTTCTCGAGAAACTCCTGAAGCTGGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks