EMAIL THIS PAGE TO A FRIEND

FAU

Finkel-Biskis-Reilly murine sarcoma virus (FBR-MuSV) ubiquitously expressed

60 Gene Product Result for
Synonyms: FAU1 Fub1 Fubi MNSFbeta RPS30 S30 asr1
UniProtKB ID: P62861, Q05472, Q95261, Q9H5V4
Gene ID:
Human(2197) Summary: This gene is the cellular homolog of the fox sequence in the Finkel-Biskis-Reilly murine sarcoma virus (FBR-MuSV). It encodes a fusion protein consisting of the ubiquitin-like protein fubi at the N terminus and ribosomal protein S30 at the C terminus. It has been proposed that the fusion protein is post-translationally processed to generate free fubi and free ribosomal protein S30. Fubi is a member of the ubiquitin family, and ribosomal protein S30 belongs to the S30E family of ribosomal proteins. Whereas the function of fubi is currently unknown, ribosomal protein S30 is a component of the 40S subunit of the cytoplasmic ribosome. Pseudogenes derived from this gene are present in the genome. Similar to ribosomal protein S30, ribosomal proteins S27a and L40 are synthesized as fusion proteins with ubiquitin. [provided by RefSeq, Jul 2008]
Mouse(14109) Finkel-Biskis-Reilly murine sarcoma virus (FBR-MuSV) ubiquitously expressed (fox derived)
Rat(29752) Finkel-Biskis-Reilly murine sarcoma virus (FBR-MuSV) ubiquitously expressed
fruit fly(41291) CG6544 gene product from transcript CG6544-RG
domestic cat(101083800) Finkel-Biskis-Reilly murine sarcoma virus (FBR-MuSV) ubiquitously expressed
cow(282847) Finkel-Biskis-Reilly murine sarcoma virus (FBR-MuSV) ubiquitously expressed
Horse(100033998) Finkel-Biskis-Reilly murine sarcoma virus (FBR-MuSV) ubiquitously expressed
dog(483748) Finkel-Biskis-Reilly murine sarcoma virus (FBR-MuSV) ubiquitously expressed
sheep(101106472) Finkel-Biskis-Reilly murine sarcoma virus (FBR-MuSV) ubiquitously expressed
naked mole-rat(101698636) Finkel-Biskis-Reilly murine sarcoma virus (FBR-MuSV) ubiquitously expressed
domestic guinea pig(100726002) Finkel-Biskis-Reilly murine sarcoma virus (FBR-MuSV) ubiquitously expressed
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007990 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007990 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007990 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001997 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001997 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001997 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001997 Rosetta Predictions human pricing
NM_001012739 Rosetta Predictions rat pricing
XM_001052979 Rosetta Predictions rat pricing
NM_007990 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001997 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00039915 predicted 277
2 SASI_Hs01_00039916 predicted 312
3 SASI_Hs01_00039917 predicted 306
4 SASI_Hs01_00039918 predicted 321
5 SASI_Hs01_00039919 predicted 302
6 SASI_Hs01_00039920 predicted 304
7 SASI_Hs01_00039921 predicted 283
8 SASI_Hs01_00039922 predicted 310
9 SASI_Hs01_00039923 predicted 302
10 SASI_Hs01_00039924 predicted 312
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012739 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00091041 predicted 289
2 SASI_Rn01_00091042 predicted 271
3 SASI_Rn01_00091043 predicted 272
4 SASI_Rn01_00091044 predicted 276
5 SASI_Rn01_00091045 predicted 279
6 SASI_Rn01_00091046 predicted 275
7 SASI_Rn01_00091047 predicted 278
8 SASI_Rn01_00091048 predicted 222
9 SASI_Rn01_00091049 predicted 232
10 SASI_Rn01_00091050 predicted 280
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001052979 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00270918 predicted 218
2 SASI_Rn02_00270919 predicted 280
3 SASI_Rn02_00270920 predicted 269
4 SASI_Rn02_00270921 predicted 285
5 SASI_Rn02_00270922 predicted 264
6 SASI_Rn02_00270923 predicted 275
7 SASI_Rn02_00270924 predicted 273
8 SASI_Rn02_00270925 predicted 274
9 SASI_Rn02_00270926 predicted 217
10 SASI_Rn02_00270927 predicted 224
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007990 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00193700 predicted 231
2 SASI_Mm01_00193703 predicted 228
3 SASI_Mm01_00193704 predicted 241
4 SASI_Mm01_00193706 predicted 274
5 SASI_Mm01_00193707 predicted 238
6 SASI_Mm01_00193708 predicted 232
7 SASI_Mm01_00193709 predicted 210
8 SASI_Mm01_00193701 predicted 267
9 SASI_Mm01_00193705 predicted 257
10 SASI_Mm02_00312903 predicted 262
11 SASI_Mm01_00193702 predicted 268
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007990
FAU MISSION shRNA Bacterial Glycerol Stock
Finkel-Biskis-Reilly murine sarcoma virus (FBR-MuSV) ubiquitously expressed
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000104130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007990.1-122s1c1
Sequence:CCGGGTCGCCCAGATCAAAGATCATCTCGAGATGATCTTTGATCTGGGCGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007990.1-276s1c1
Sequence:CCGGTGGGAGGTAAAGTTCACGGTTCTCGAGAACCGTGAACTTTACCTCCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007990.1-167s1c1
Sequence:CCGGCCCGAAGATCAAGTCGTGCTTCTCGAGAAGCACGACTTGATCTTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007990.1-319s1c1
Sequence:CCGGGAGAGGTCAGACTCCCAAGGTCTCGAGACCTTGGGAGTCTGACCTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007990.1-253s1c1
Sequence:CCGGTCTGGAAGTAGCAGGCCGCATCTCGAGATGCGGCCTGCTACTTCCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007990
FAU MISSION shRNA shRNA Plasmid DNA
Finkel-Biskis-Reilly murine sarcoma virus (FBR-MuSV) ubiquitously expressed
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000104130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007990.1-122s1c1
Sequence:CCGGGTCGCCCAGATCAAAGATCATCTCGAGATGATCTTTGATCTGGGCGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007990.1-276s1c1
Sequence:CCGGTGGGAGGTAAAGTTCACGGTTCTCGAGAACCGTGAACTTTACCTCCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007990.1-167s1c1
Sequence:CCGGCCCGAAGATCAAGTCGTGCTTCTCGAGAAGCACGACTTGATCTTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007990.1-319s1c1
Sequence:CCGGGAGAGGTCAGACTCCCAAGGTCTCGAGACCTTGGGAGTCTGACCTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007990.1-253s1c1
Sequence:CCGGTCTGGAAGTAGCAGGCCGCATCTCGAGATGCGGCCTGCTACTTCCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007990
FAU MISSION shRNA Lentiviral Transduction Particles
Finkel-Biskis-Reilly murine sarcoma virus (FBR-MuSV) ubiquitously expressed
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000104130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007990.1-122s1c1
Sequence:CCGGGTCGCCCAGATCAAAGATCATCTCGAGATGATCTTTGATCTGGGCGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007990.1-276s1c1
Sequence:CCGGTGGGAGGTAAAGTTCACGGTTCTCGAGAACCGTGAACTTTACCTCCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007990.1-167s1c1
Sequence:CCGGCCCGAAGATCAAGTCGTGCTTCTCGAGAAGCACGACTTGATCTTCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007990.1-319s1c1
Sequence:CCGGGAGAGGTCAGACTCCCAAGGTCTCGAGACCTTGGGAGTCTGACCTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007990.1-253s1c1
Sequence:CCGGTCTGGAAGTAGCAGGCCGCATCTCGAGATGCGGCCTGCTACTTCCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001997
VALIDATED
FAU MISSION shRNA Bacterial Glycerol Stock
Finkel-Biskis-Reilly murine sarcoma virus (FBR-MuSV) ubiquitously expressed
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000007178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_001997.2-187s1c1
Sequence:CCGGGTAGCCTCACTGGAGGGCATTCTCGAGAATGCCCTCCAGTGAGGCTACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_001997.2-296s1c1
Sequence:CCGGCCCTGGAAGTAGCAGGCCGCACTCGAGTGCGGCCTGCTACTTCCAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_001997.2-370s1c1
Sequence:CCGGCAGACTCCTAAGGTGGCCAAACTCGAGTTTGGCCACCTTAGGAGTCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001997.2-405s1c1
Sequence:CCGGGAAGAAGACAGGTCGGGCTAACTCGAGTTAGCCCGACCTGTCTTCTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_001997.2-166s1c1
Sequence:CCGGGTCGCCCAGATCAAGGCTCATCTCGAGATGAGCCTTGATCTGGGCGACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001997.3-298s21c1
Sequence:CCGGCCCTGGAAGTAGCAGGCCGCACTCGAGTGCGGCCTGCTACTTCCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001997.3-372s21c1
Sequence:CCGGCAGACTCCTAAGGTGGCCAAACTCGAGTTTGGCCACCTTAGGAGTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001997.3-407s21c1
Sequence:CCGGGAAGAAGACAGGTCGGGCTAACTCGAGTTAGCCCGACCTGTCTTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001997.3-168s21c1
Sequence:CCGGGTCGCCCAGATCAAGGCTCATCTCGAGATGAGCCTTGATCTGGGCGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001997
VALIDATED
FAU MISSION shRNA shRNA Plasmid DNA
Finkel-Biskis-Reilly murine sarcoma virus (FBR-MuSV) ubiquitously expressed
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000007178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_001997.2-187s1c1
Sequence:CCGGGTAGCCTCACTGGAGGGCATTCTCGAGAATGCCCTCCAGTGAGGCTACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_001997.2-296s1c1
Sequence:CCGGCCCTGGAAGTAGCAGGCCGCACTCGAGTGCGGCCTGCTACTTCCAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_001997.2-370s1c1
Sequence:CCGGCAGACTCCTAAGGTGGCCAAACTCGAGTTTGGCCACCTTAGGAGTCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001997.2-405s1c1
Sequence:CCGGGAAGAAGACAGGTCGGGCTAACTCGAGTTAGCCCGACCTGTCTTCTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_001997.2-166s1c1
Sequence:CCGGGTCGCCCAGATCAAGGCTCATCTCGAGATGAGCCTTGATCTGGGCGACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001997.3-298s21c1
Sequence:CCGGCCCTGGAAGTAGCAGGCCGCACTCGAGTGCGGCCTGCTACTTCCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001997.3-372s21c1
Sequence:CCGGCAGACTCCTAAGGTGGCCAAACTCGAGTTTGGCCACCTTAGGAGTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001997.3-407s21c1
Sequence:CCGGGAAGAAGACAGGTCGGGCTAACTCGAGTTAGCCCGACCTGTCTTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001997.3-168s21c1
Sequence:CCGGGTCGCCCAGATCAAGGCTCATCTCGAGATGAGCCTTGATCTGGGCGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001997
VALIDATED
FAU MISSION shRNA Lentiviral Transduction Particles
Finkel-Biskis-Reilly murine sarcoma virus (FBR-MuSV) ubiquitously expressed
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000007178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_001997.2-187s1c1
Sequence:CCGGGTAGCCTCACTGGAGGGCATTCTCGAGAATGCCCTCCAGTGAGGCTACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_001997.2-296s1c1
Sequence:CCGGCCCTGGAAGTAGCAGGCCGCACTCGAGTGCGGCCTGCTACTTCCAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_001997.2-370s1c1
Sequence:CCGGCAGACTCCTAAGGTGGCCAAACTCGAGTTTGGCCACCTTAGGAGTCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001997.2-405s1c1
Sequence:CCGGGAAGAAGACAGGTCGGGCTAACTCGAGTTAGCCCGACCTGTCTTCTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_001997.2-166s1c1
Sequence:CCGGGTCGCCCAGATCAAGGCTCATCTCGAGATGAGCCTTGATCTGGGCGACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001997.3-298s21c1
Sequence:CCGGCCCTGGAAGTAGCAGGCCGCACTCGAGTGCGGCCTGCTACTTCCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001997.3-372s21c1
Sequence:CCGGCAGACTCCTAAGGTGGCCAAACTCGAGTTTGGCCACCTTAGGAGTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001997.3-407s21c1
Sequence:CCGGGAAGAAGACAGGTCGGGCTAACTCGAGTTAGCCCGACCTGTCTTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001997.3-168s21c1
Sequence:CCGGGTCGCCCAGATCAAGGCTCATCTCGAGATGAGCCTTGATCTGGGCGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)