EMAIL THIS PAGE TO A FRIEND

FAXC

failed axon connections homolog (Drosophila)

83 Gene Product Result for
Synonyms: C6orf168 dJ273F20
UniProtKB ID: Q5TGI0, B3KU39, Q96F61, Q96LU3, Q9BSS2
Gene ID:
Mouse(76132) failed axon connections homolog (Drosophila)
Rat(366333) failed axon connections
domestic cat(101084450) failed axon connections homolog (Drosophila)
cow(783090) failed axon connections homolog (Drosophila)
dog(475003) failed axon connections homolog (Drosophila)
sheep(101104245) failed axon connections homolog (Drosophila)
domestic guinea pig(100724003) failed axon connections homolog (Drosophila)
naked mole-rat(101716338) failed axon connections homolog (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032511 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032511 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032511 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175234 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175234 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175234 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032511 Rosetta Predictions human pricing
XM_001059208 Rosetta Predictions rat pricing
XM_575784 Rosetta Predictions rat pricing
NM_175234 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032511 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00107290 predicted 784
2 SASI_Hs01_00107291 predicted 616
3 SASI_Hs01_00107292 predicted 561
4 SASI_Hs02_00360004 predicted 662
5 SASI_Hs01_00107293 predicted 1219
6 SASI_Hs01_00107294 predicted 722
7 SASI_Hs01_00107296 predicted 1295
8 SASI_Hs01_00107297 predicted 883
9 SASI_Hs01_00107298 predicted 586
10 SASI_Hs02_00360005 predicted 866
11 SASI_Hs01_00107295 predicted 1382
12 SASI_Hs01_00107299 predicted 1188
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059208 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00292410 predicted 913
2 SASI_Rn02_00292411 predicted 521
3 SASI_Rn02_00292412 predicted 1418
4 SASI_Rn02_00292413 predicted 758
5 SASI_Rn02_00292414 predicted 1172
6 SASI_Rn02_00292415 predicted 1468
7 SASI_Rn02_00292416 predicted 1203
8 SASI_Rn02_00292417 predicted 1051
9 SASI_Rn02_00292418 predicted 1451
10 SASI_Rn02_00292419 predicted 1123
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575784 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00404333 predicted 921
2 SASI_Rn02_00404334 predicted 1416
3 SASI_Rn02_00404335 predicted 1164
4 SASI_Rn02_00404336 predicted 1469
5 SASI_Rn02_00404337 predicted 1201
6 SASI_Rn02_00404338 predicted 1046
7 SASI_Rn02_00404339 predicted 1452
8 SASI_Rn02_00404340 predicted 1123
9 SASI_Rn02_00404341 predicted 1382
10 SASI_Rn02_00404342 predicted 911
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175234 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00124089 predicted 662
2 SASI_Mm02_00345911 predicted 739
3 SASI_Mm02_00345912 predicted 1150
4 SASI_Mm02_00345913 predicted 784
5 SASI_Mm02_00345914 predicted 1180
6 SASI_Mm02_00345915 predicted 1249
7 SASI_Mm02_00345916 predicted 543
8 SASI_Mm02_00345917 predicted 1168
9 SASI_Mm02_00345918 predicted 837
10 SASI_Mm02_00345919 predicted 1138
11 SASI_Mm01_00124090 predicted 367
12 SASI_Mm01_00124091 predicted 1266
13 SASI_Mm01_00124092 predicted 1334
14 SASI_Mm01_00124093 predicted 520
15 SASI_Mm01_00124094 predicted 542
16 SASI_Mm01_00124095 predicted 1229
17 SASI_Mm01_00124096 predicted 1280
18 SASI_Mm01_00124097 predicted 615
19 SASI_Mm01_00124098 predicted 740
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032511
FAXC MISSION shRNA Bacterial Glycerol Stock
failed axon connections homolog (Drosophila)
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000142520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032511.1-985s1c1
Sequence:CCGGGTGCCACATAACGAAAGGAATCTCGAGATTCCTTTCGTTATGTGGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032511.1-1481s1c1
Sequence:CCGGGATGACTATACAGACCACGAACTCGAGTTCGTGGTCTGTATAGTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141386    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032511.1-1288s1c1
Sequence:CCGGCCACGATGATGACAATACCATCTCGAGATGGTATTGTCATCATCGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142017    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032511.1-1734s1c1
Sequence:CCGGGCATGGTTCCTGAAATCCATTCTCGAGAATGGATTTCAGGAACCATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139241    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032511.1-926s1c1
Sequence:CCGGCGGAAGATGCTCTCTCTTAGTCTCGAGACTAAGAGAGAGCATCTTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140243    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032511.1-1809s1c1
Sequence:CCGGGCTGGTTGTCAGCTGATAGTTCTCGAGAACTATCAGCTGACAACCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032511.1-1463s1c1
Sequence:CCGGGATTCGGATGTGGACATGGATCTCGAGATCCATGTCCACATCCGAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142199    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032511.1-1870s1c1
Sequence:CCGGGATGGATTCTTGAACCTCCTTCTCGAGAAGGAGGTTCAAGAATCCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145447    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032511.1-556s1c1
Sequence:CCGGGCAAGAGATTGACTCTAAAGACTCGAGTCTTTAGAGTCAATCTCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032511.1-671s1c1
Sequence:CCGGGACTTACCGTATCAGAACTATCTCGAGATAGTTCTGATACGGTAAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032511.1-1291s1c1
Sequence:CCGGCGATGATGACAATACCATCTACTCGAGTAGATGGTATTGTCATCATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032511
FAXC MISSION shRNA shRNA Plasmid DNA
failed axon connections homolog (Drosophila)
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000142520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032511.1-985s1c1
Sequence:CCGGGTGCCACATAACGAAAGGAATCTCGAGATTCCTTTCGTTATGTGGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032511.1-1481s1c1
Sequence:CCGGGATGACTATACAGACCACGAACTCGAGTTCGTGGTCTGTATAGTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141386    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032511.1-1288s1c1
Sequence:CCGGCCACGATGATGACAATACCATCTCGAGATGGTATTGTCATCATCGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142017    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032511.1-1734s1c1
Sequence:CCGGGCATGGTTCCTGAAATCCATTCTCGAGAATGGATTTCAGGAACCATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139241    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032511.1-926s1c1
Sequence:CCGGCGGAAGATGCTCTCTCTTAGTCTCGAGACTAAGAGAGAGCATCTTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140243    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032511.1-1809s1c1
Sequence:CCGGGCTGGTTGTCAGCTGATAGTTCTCGAGAACTATCAGCTGACAACCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032511.1-1463s1c1
Sequence:CCGGGATTCGGATGTGGACATGGATCTCGAGATCCATGTCCACATCCGAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142199    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032511.1-1870s1c1
Sequence:CCGGGATGGATTCTTGAACCTCCTTCTCGAGAAGGAGGTTCAAGAATCCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145447    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032511.1-556s1c1
Sequence:CCGGGCAAGAGATTGACTCTAAAGACTCGAGTCTTTAGAGTCAATCTCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032511.1-671s1c1
Sequence:CCGGGACTTACCGTATCAGAACTATCTCGAGATAGTTCTGATACGGTAAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032511.1-1291s1c1
Sequence:CCGGCGATGATGACAATACCATCTACTCGAGTAGATGGTATTGTCATCATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032511
FAXC MISSION shRNA Lentiviral Transduction Particles
failed axon connections homolog (Drosophila)
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000142520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032511.1-985s1c1
Sequence:CCGGGTGCCACATAACGAAAGGAATCTCGAGATTCCTTTCGTTATGTGGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032511.1-1481s1c1
Sequence:CCGGGATGACTATACAGACCACGAACTCGAGTTCGTGGTCTGTATAGTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141386    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032511.1-1288s1c1
Sequence:CCGGCCACGATGATGACAATACCATCTCGAGATGGTATTGTCATCATCGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142017    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032511.1-1734s1c1
Sequence:CCGGGCATGGTTCCTGAAATCCATTCTCGAGAATGGATTTCAGGAACCATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139241    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032511.1-926s1c1
Sequence:CCGGCGGAAGATGCTCTCTCTTAGTCTCGAGACTAAGAGAGAGCATCTTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140243    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032511.1-1809s1c1
Sequence:CCGGGCTGGTTGTCAGCTGATAGTTCTCGAGAACTATCAGCTGACAACCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032511.1-1463s1c1
Sequence:CCGGGATTCGGATGTGGACATGGATCTCGAGATCCATGTCCACATCCGAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142199    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032511.1-1870s1c1
Sequence:CCGGGATGGATTCTTGAACCTCCTTCTCGAGAAGGAGGTTCAAGAATCCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145447    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032511.1-556s1c1
Sequence:CCGGGCAAGAGATTGACTCTAAAGACTCGAGTCTTTAGAGTCAATCTCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032511.1-671s1c1
Sequence:CCGGGACTTACCGTATCAGAACTATCTCGAGATAGTTCTGATACGGTAAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032511.1-1291s1c1
Sequence:CCGGCGATGATGACAATACCATCTACTCGAGTAGATGGTATTGTCATCATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175234
FAXC MISSION shRNA Bacterial Glycerol Stock
failed axon connections homolog (Drosophila)
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000193397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175234.2-542s1c1
Sequence:CCGGCAGTTTGCAAGACCTAACAATCTCGAGATTGTTAGGTCTTGCAAACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175234.2-622s1c1
Sequence:CCGGCCTACCCTATCAGAACTATTTCTCGAGAAATAGTTCTGATAGGGTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175234.2-620s1c1
Sequence:CCGGGACCTACCCTATCAGAACTATCTCGAGATAGTTCTGATAGGGTAGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175383    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175234.2-896s1c1
Sequence:CCGGCCGTCAGATTTCTGACACTTACTCGAGTAAGTGTCAGAAATCTGACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175234
FAXC MISSION shRNA shRNA Plasmid DNA
failed axon connections homolog (Drosophila)
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000193397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175234.2-542s1c1
Sequence:CCGGCAGTTTGCAAGACCTAACAATCTCGAGATTGTTAGGTCTTGCAAACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175234.2-622s1c1
Sequence:CCGGCCTACCCTATCAGAACTATTTCTCGAGAAATAGTTCTGATAGGGTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175234.2-620s1c1
Sequence:CCGGGACCTACCCTATCAGAACTATCTCGAGATAGTTCTGATAGGGTAGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175383    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175234.2-896s1c1
Sequence:CCGGCCGTCAGATTTCTGACACTTACTCGAGTAAGTGTCAGAAATCTGACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175234
FAXC MISSION shRNA Lentiviral Transduction Particles
failed axon connections homolog (Drosophila)
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000193397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175234.2-542s1c1
Sequence:CCGGCAGTTTGCAAGACCTAACAATCTCGAGATTGTTAGGTCTTGCAAACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175234.2-622s1c1
Sequence:CCGGCCTACCCTATCAGAACTATTTCTCGAGAAATAGTTCTGATAGGGTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175234.2-620s1c1
Sequence:CCGGGACCTACCCTATCAGAACTATCTCGAGATAGTTCTGATAGGGTAGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175383    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175234.2-896s1c1
Sequence:CCGGCCGTCAGATTTCTGACACTTACTCGAGTAAGTGTCAGAAATCTGACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)