EMAIL THIS PAGE TO A FRIEND

FAXDC2

fatty acid hydroxylase domain containing 2

90 Gene Product Result for
Synonyms: C5orf4
UniProtKB ID: Q96IV6, Q9BSX6, Q9H8C7
Gene ID:
Rat(691221) fatty acid hydroxylase domain containing 2
Zebrafish(406828) fatty acid hydroxylase domain containing 2
cow(785044) fatty acid hydroxylase domain containing 2
dog(489163) fatty acid hydroxylase domain containing 2
domestic guinea pig(100727233) fatty acid hydroxylase domain containing 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV42675 Anti-C5ORF4 antibody produced in rabbit affinity isolated antibody horse, guinea pig, rabbit, bovine, canine, human
immunohistochemistry, western blot pricing
HPA014775 Anti-FAXDC2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016348 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016348 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016348 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU032231 MISSION® esiRNA esiRNA human C5orf4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016348 Rosetta Predictions human pricing
NM_032385 Rosetta Predictions human pricing
XM_001077260 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016348 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00349307 predicted 1268
2 SASI_Hs02_00349308 predicted 1266
3 SASI_Hs01_00094130 predicted 1717
4 SASI_Hs01_00094131 predicted 1904
5 SASI_Hs01_00094132 predicted 1017
6 SASI_Hs01_00094133 predicted 1546
7 SASI_Hs01_00094134 predicted 1116
8 SASI_Hs01_00094135 predicted 1204
9 SASI_Hs01_00094136 predicted 1704
10 SASI_Hs01_00094137 predicted 1911
11 SASI_Hs01_00094129 predicted 1166
12 SASI_Hs01_00094138 predicted 1333
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032385 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00359782 predicted 1226
2 SASI_Hs02_00359783 predicted 1227
3 SASI_Hs01_00142136 predicted 869
4 SASI_Hs02_00359784 predicted 1008
5 SASI_Hs01_00142137 predicted 441
6 SASI_Hs01_00142138 predicted 544
7 SASI_Hs01_00142139 predicted 861
8 SASI_Hs01_00142135 predicted 716
9 SASI_Hs01_00142140 predicted 814
10 SASI_Hs01_00142141 predicted 484
11 SASI_Hs01_00142142 predicted 464
12 SASI_Hs01_00142143 predicted 263
13 SASI_Hs01_00142144 predicted 420
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077260 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00356433 predicted 1209
2 SASI_Rn02_00356434 predicted 1410
3 SASI_Rn02_00356435 predicted 930
4 SASI_Rn02_00356436 predicted 1127
5 SASI_Rn02_00356437 predicted 1372
6 SASI_Rn02_00356438 predicted 990
7 SASI_Rn02_00356439 predicted 963
8 SASI_Rn02_00356440 predicted 950
9 SASI_Rn02_00356441 predicted 684
10 SASI_Rn02_00356442 predicted 906
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016348
VALIDATED
FAXDC2 MISSION shRNA Bacterial Glycerol Stock
fatty acid hydroxylase domain containing 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000142677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016348.1-1266s1c1
Sequence:CCGGCTTCCTGATTGCACCTAACAACTCGAGTTGTTAGGTGCAATCAGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141071    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016348.1-2055s1c1
Sequence:CCGGCCTATCTGAATGAGGACCAAACTCGAGTTTGGTCCTCATTCAGATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016348.1-1048s1c1
Sequence:CCGGCTTCTAGGTTCAACCAGTGCTCTCGAGAGCACTGGTTGAACCTAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016348.1-1109s1c1
Sequence:CCGGCACCATGTTCAAGCAGACCAACTCGAGTTGGTCTGCTTGAACATGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140038    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016348.1-1551s1c1
Sequence:CCGGGCAGAGAATGACAAGGCTGAACTCGAGTTCAGCCTTGTCATTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016348.1-1276s1c1
Sequence:CCGGGCACCTAACAATTTGCCTCCTCTCGAGAGGAGGCAAATTGTTAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140962    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016348.1-1380s1c1
Sequence:CCGGCTTCAAACTACTGCCCTTGATCTCGAGATCAAGGGCAGTAGTTTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016348.1-1277s1c1
Sequence:CCGGCACCTAACAATTTGCCTCCTTCTCGAGAAGGAGGCAAATTGTTAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016348.1-1372s1c1
Sequence:CCGGGAGGCTTTCTTCAAACTACTGCTCGAGCAGTAGTTTGAAGAAAGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016348
VALIDATED
FAXDC2 MISSION shRNA shRNA Plasmid DNA
fatty acid hydroxylase domain containing 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000142677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016348.1-1266s1c1
Sequence:CCGGCTTCCTGATTGCACCTAACAACTCGAGTTGTTAGGTGCAATCAGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141071    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016348.1-2055s1c1
Sequence:CCGGCCTATCTGAATGAGGACCAAACTCGAGTTTGGTCCTCATTCAGATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016348.1-1048s1c1
Sequence:CCGGCTTCTAGGTTCAACCAGTGCTCTCGAGAGCACTGGTTGAACCTAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016348.1-1109s1c1
Sequence:CCGGCACCATGTTCAAGCAGACCAACTCGAGTTGGTCTGCTTGAACATGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140038    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016348.1-1551s1c1
Sequence:CCGGGCAGAGAATGACAAGGCTGAACTCGAGTTCAGCCTTGTCATTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016348.1-1276s1c1
Sequence:CCGGGCACCTAACAATTTGCCTCCTCTCGAGAGGAGGCAAATTGTTAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140962    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016348.1-1380s1c1
Sequence:CCGGCTTCAAACTACTGCCCTTGATCTCGAGATCAAGGGCAGTAGTTTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016348.1-1277s1c1
Sequence:CCGGCACCTAACAATTTGCCTCCTTCTCGAGAAGGAGGCAAATTGTTAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016348.1-1372s1c1
Sequence:CCGGGAGGCTTTCTTCAAACTACTGCTCGAGCAGTAGTTTGAAGAAAGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016348
VALIDATED
FAXDC2 MISSION shRNA Lentiviral Transduction Particles
fatty acid hydroxylase domain containing 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000142677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016348.1-1266s1c1
Sequence:CCGGCTTCCTGATTGCACCTAACAACTCGAGTTGTTAGGTGCAATCAGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141071    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016348.1-2055s1c1
Sequence:CCGGCCTATCTGAATGAGGACCAAACTCGAGTTTGGTCCTCATTCAGATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016348.1-1048s1c1
Sequence:CCGGCTTCTAGGTTCAACCAGTGCTCTCGAGAGCACTGGTTGAACCTAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016348.1-1109s1c1
Sequence:CCGGCACCATGTTCAAGCAGACCAACTCGAGTTGGTCTGCTTGAACATGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140038    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016348.1-1551s1c1
Sequence:CCGGGCAGAGAATGACAAGGCTGAACTCGAGTTCAGCCTTGTCATTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016348.1-1276s1c1
Sequence:CCGGGCACCTAACAATTTGCCTCCTCTCGAGAGGAGGCAAATTGTTAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140962    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016348.1-1380s1c1
Sequence:CCGGCTTCAAACTACTGCCCTTGATCTCGAGATCAAGGGCAGTAGTTTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016348.1-1277s1c1
Sequence:CCGGCACCTAACAATTTGCCTCCTTCTCGAGAAGGAGGCAAATTGTTAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016348.1-1372s1c1
Sequence:CCGGGAGGCTTTCTTCAAACTACTGCTCGAGCAGTAGTTTGAAGAAAGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks