EMAIL THIS PAGE TO A FRIEND

FBF1

Fas (TNFRSF6) binding factor 1

95 Gene Product Result for
Synonyms: Alb FBF-1
UniProtKB ID: Q8TES7, B5MEM5, Q96IF6, Q96JG4, Q96MA8
Gene ID:
Mouse(217335) Fas (TNFRSF6) binding factor 1
Rat(287836) Fas (TNFRSF6) binding factor 1
chicken(770159) Fas (TNFRSF6) binding factor 1
domestic cat(101095932) Fas (TNFRSF6) binding factor 1
Horse(100059271) Fas (TNFRSF6) binding factor 1
dog(483321) Fas (TNFRSF6) binding factor 1
cow(513998) Fas (TNFRSF6) binding factor 1
domestic guinea pig(100726154) Fas (TNFRSF6) binding factor 1
naked mole-rat(101703320) Fas (TNFRSF6) binding factor 1
sheep(101118886) Fas (TNFRSF6) binding factor 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302949 ANTI-FBF1 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172571 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172571 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172571 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001080542 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080542 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080542 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU096321 MISSION® esiRNA esiRNA human FBF1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080542 Rosetta Predictions human pricing
XM_371079 Rosetta Predictions human pricing
XM_932824 Rosetta Predictions human pricing
XM_932831 Rosetta Predictions human pricing
XM_932838 Rosetta Predictions human pricing
XM_932840 Rosetta Predictions human pricing
NM_001105854 Rosetta Predictions rat pricing
NM_172571 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080542 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00315838 predicted 3632
2 SASI_Hs02_00315839 predicted 290
3 SASI_Hs02_00315840 predicted 731
4 SASI_Hs02_00315841 predicted 513
5 SASI_Hs02_00315842 predicted 527
6 SASI_Hs02_00315843 predicted 817
7 SASI_Hs02_00315844 predicted 2926
8 SASI_Hs02_00315845 predicted 1121
9 SASI_Hs02_00315846 predicted 359
10 SASI_Hs02_00315847 predicted 2990
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_371079 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00296344 predicted 1971
2 SASI_Hs01_00296345 predicted 1055
3 SASI_Hs01_00296346 predicted 1839
4 SASI_Hs01_00296347 predicted 1228
5 SASI_Hs01_00296348 predicted 1450
6 SASI_Hs01_00296349 predicted 1117
7 SASI_Hs01_00296350 predicted 1183
8 SASI_Hs01_00296351 predicted 1603
9 SASI_Hs01_00296352 predicted 1353
10 SASI_Hs01_00296353 predicted 1290
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932824 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00255528 predicted 463
2 SASI_Hs01_00255529 predicted 479
3 SASI_Hs01_00255530 predicted 203
4 SASI_Hs01_00255531 predicted 768
5 SASI_Hs01_00255532 predicted 196
6 SASI_Hs01_00255533 predicted 475
7 SASI_Hs01_00255534 predicted 674
8 SASI_Hs01_00255535 predicted 711
9 SASI_Hs01_00255536 predicted 312
10 SASI_Hs01_00255537 predicted 666
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932831 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00258120 predicted 899
2 SASI_Hs01_00258121 predicted 1687
3 SASI_Hs01_00258122 predicted 1075
4 SASI_Hs01_00258123 predicted 1296
5 SASI_Hs01_00258124 predicted 972
6 SASI_Hs01_00258125 predicted 915
7 SASI_Hs01_00258126 predicted 1029
8 SASI_Hs01_00258127 predicted 794
9 SASI_Hs01_00258128 predicted 1442
10 SASI_Hs01_00258129 predicted 1201
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932838 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00270979 predicted 1963
2 SASI_Hs01_00270980 predicted 1054
3 SASI_Hs01_00270981 predicted 1839
4 SASI_Hs01_00270982 predicted 1228
5 SASI_Hs01_00270983 predicted 1442
6 SASI_Hs01_00270984 predicted 1119
7 SASI_Hs01_00270985 predicted 1189
8 SASI_Hs01_00270986 predicted 1603
9 SASI_Hs01_00270987 predicted 1348
10 SASI_Hs01_00270988 predicted 1298
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932840 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00301044 predicted 1919
2 SASI_Hs01_00301045 predicted 1010
3 SASI_Hs01_00301046 predicted 1787
4 SASI_Hs01_00301047 predicted 1187
5 SASI_Hs01_00301048 predicted 1394
6 SASI_Hs01_00301049 predicted 1071
7 SASI_Hs01_00301050 predicted 1138
8 SASI_Hs01_00301051 predicted 1549
9 SASI_Hs01_00301052 predicted 1303
10 SASI_Hs01_00301053 predicted 1248
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105854 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00213182 predicted 4134
2 SASI_Rn02_00213183 predicted 3355
3 SASI_Rn02_00213184 predicted 4159
4 SASI_Rn02_00213185 predicted 3554
5 SASI_Rn02_00213186 predicted 2644
6 SASI_Rn02_00213187 predicted 2582
7 SASI_Rn02_00213188 predicted 2762
8 SASI_Rn02_00213189 predicted 2625
9 SASI_Rn02_00213190 predicted 4116
10 SASI_Rn02_00213191 predicted 4132
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172571 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00149131 predicted 4242
2 SASI_Mm02_00344231 predicted 3815
3 SASI_Mm01_00149133 predicted 4223
4 SASI_Mm02_00344232 predicted 1436
5 SASI_Mm02_00344233 predicted 1290
6 SASI_Mm01_00149135 predicted 2377
7 SASI_Mm02_00344234 predicted 3622
8 SASI_Mm02_00344235 predicted 2373
9 SASI_Mm02_00344236 predicted 4231
10 SASI_Mm01_00149136 predicted 1136
11 SASI_Mm01_00149132 predicted 2050
12 SASI_Mm01_00149134 predicted 1424
13 SASI_Mm01_00149137 predicted 1409
14 SASI_Mm01_00149138 predicted 2482
15 SASI_Mm01_00149139 predicted 2323
16 SASI_Mm01_00149140 predicted 1193
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172571
VALIDATED
FBF1 MISSION shRNA Bacterial Glycerol Stock
Fas (TNFRSF6) binding factor 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000192020    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172571.2-1435s1c1
Sequence:CCGGCCATGTCATATCTCAGAAGAACTCGAGTTCTTCTGAGATATGACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189762    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172571.2-1586s1c1
Sequence:CCGGGCCTCGAAACCAACTACACAACTCGAGTTGTGTAGTTGGTTTCGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190152    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172571.2-2052s1c1
Sequence:CCGGGCCGTATCAAGGTGCTAGAAACTCGAGTTTCTAGCACCTTGATACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172571.3-1163s21c1
Sequence:CCGGACAAGCCTGCTGGCACATTAACTCGAGTTAATGTGCCAGCAGGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172571.3-4234s21c1
Sequence:CCGGCTGAAGAAAGCACCCTATAATCTCGAGATTATAGGGTGCTTTCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217847    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172571.3-4501s1c1
Sequence:CCGGCTTAGCACCCATCATAGTAAGCTCGAGCTTACTATGATGGGTGCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172571.3-2442s21c1
Sequence:CCGGTAGCAGAGAGCCTGCGGTTTACTCGAGTAAACCGCAGGCTCTCTGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250912    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172571.3-4736s21c1
Sequence:CCGGCATGCCCAGATGGATTGATTCCTCGAGGAATCAATCCATCTGGGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172571.3-2840s21c1
Sequence:CCGGCAGCTCAGCATGCGTCATATTCTCGAGAATATGACGCATGCTGAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172571
VALIDATED
FBF1 MISSION shRNA shRNA Plasmid DNA
Fas (TNFRSF6) binding factor 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000192020    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172571.2-1435s1c1
Sequence:CCGGCCATGTCATATCTCAGAAGAACTCGAGTTCTTCTGAGATATGACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189762    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172571.2-1586s1c1
Sequence:CCGGGCCTCGAAACCAACTACACAACTCGAGTTGTGTAGTTGGTTTCGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190152    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172571.2-2052s1c1
Sequence:CCGGGCCGTATCAAGGTGCTAGAAACTCGAGTTTCTAGCACCTTGATACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172571.3-1163s21c1
Sequence:CCGGACAAGCCTGCTGGCACATTAACTCGAGTTAATGTGCCAGCAGGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172571.3-4234s21c1
Sequence:CCGGCTGAAGAAAGCACCCTATAATCTCGAGATTATAGGGTGCTTTCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217847    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172571.3-4501s1c1
Sequence:CCGGCTTAGCACCCATCATAGTAAGCTCGAGCTTACTATGATGGGTGCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172571.3-2442s21c1
Sequence:CCGGTAGCAGAGAGCCTGCGGTTTACTCGAGTAAACCGCAGGCTCTCTGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250912    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172571.3-4736s21c1
Sequence:CCGGCATGCCCAGATGGATTGATTCCTCGAGGAATCAATCCATCTGGGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172571.3-2840s21c1
Sequence:CCGGCAGCTCAGCATGCGTCATATTCTCGAGAATATGACGCATGCTGAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172571
VALIDATED
FBF1 MISSION shRNA Lentiviral Transduction Particles
Fas (TNFRSF6) binding factor 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000192020    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172571.2-1435s1c1
Sequence:CCGGCCATGTCATATCTCAGAAGAACTCGAGTTCTTCTGAGATATGACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189762    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172571.2-1586s1c1
Sequence:CCGGGCCTCGAAACCAACTACACAACTCGAGTTGTGTAGTTGGTTTCGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190152    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172571.2-2052s1c1
Sequence:CCGGGCCGTATCAAGGTGCTAGAAACTCGAGTTTCTAGCACCTTGATACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172571.3-1163s21c1
Sequence:CCGGACAAGCCTGCTGGCACATTAACTCGAGTTAATGTGCCAGCAGGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172571.3-4234s21c1
Sequence:CCGGCTGAAGAAAGCACCCTATAATCTCGAGATTATAGGGTGCTTTCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217847    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172571.3-4501s1c1
Sequence:CCGGCTTAGCACCCATCATAGTAAGCTCGAGCTTACTATGATGGGTGCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172571.3-2442s21c1
Sequence:CCGGTAGCAGAGAGCCTGCGGTTTACTCGAGTAAACCGCAGGCTCTCTGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250912    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172571.3-4736s21c1
Sequence:CCGGCATGCCCAGATGGATTGATTCCTCGAGGAATCAATCCATCTGGGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172571.3-2840s21c1
Sequence:CCGGCAGCTCAGCATGCGTCATATTCTCGAGAATATGACGCATGCTGAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080542
VALIDATED
FBF1 MISSION shRNA Bacterial Glycerol Stock
Fas (TNFRSF6) binding factor 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080542.1-517s21c1
Sequence:CCGGGGACGGCATGGATGCTGATATCTCGAGATATCAGCATCCATGCCGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080542.1-311s21c1
Sequence:CCGGCTACCTGAGAAGCCTGTTAAACTCGAGTTTAACAGGCTTCTCAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080542.1-2164s21c1
Sequence:CCGGCCGCATCAAGGTGCTAGAAACCTCGAGGTTTCTAGCACCTTGATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080542.1-540s21c1
Sequence:CCGGTAGGTCTGAAGAAATCTAATTCTCGAGAATTAGATTTCTTCAGACCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080542.1-3636s21c1
Sequence:CCGGTGAAGAAAGGGTCCTACAATTCTCGAGAATTGTAGGACCCTTTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080542
VALIDATED
FBF1 MISSION shRNA shRNA Plasmid DNA
Fas (TNFRSF6) binding factor 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080542.1-517s21c1
Sequence:CCGGGGACGGCATGGATGCTGATATCTCGAGATATCAGCATCCATGCCGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080542.1-311s21c1
Sequence:CCGGCTACCTGAGAAGCCTGTTAAACTCGAGTTTAACAGGCTTCTCAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080542.1-2164s21c1
Sequence:CCGGCCGCATCAAGGTGCTAGAAACCTCGAGGTTTCTAGCACCTTGATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080542.1-540s21c1
Sequence:CCGGTAGGTCTGAAGAAATCTAATTCTCGAGAATTAGATTTCTTCAGACCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080542.1-3636s21c1
Sequence:CCGGTGAAGAAAGGGTCCTACAATTCTCGAGAATTGTAGGACCCTTTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080542
VALIDATED
FBF1 MISSION shRNA Lentiviral Transduction Particles
Fas (TNFRSF6) binding factor 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080542.1-517s21c1
Sequence:CCGGGGACGGCATGGATGCTGATATCTCGAGATATCAGCATCCATGCCGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080542.1-311s21c1
Sequence:CCGGCTACCTGAGAAGCCTGTTAAACTCGAGTTTAACAGGCTTCTCAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080542.1-2164s21c1
Sequence:CCGGCCGCATCAAGGTGCTAGAAACCTCGAGGTTTCTAGCACCTTGATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080542.1-540s21c1
Sequence:CCGGTAGGTCTGAAGAAATCTAATTCTCGAGAATTAGATTTCTTCAGACCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080542.1-3636s21c1
Sequence:CCGGTGAAGAAAGGGTCCTACAATTCTCGAGAATTGTAGGACCCTTTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks