EMAIL THIS PAGE TO A FRIEND

FBL

fibrillarin

63 Gene Product Result for
Synonyms: FIB FLRN RNU3IP1
UniProtKB ID: P22087, B5BUE8, O75259, Q6IAT5, Q9UPI6
Gene ID:
Human(2091) Summary: This gene product is a component of a nucleolar small nuclear ribonucleoprotein (snRNP) particle thought to participate in the first step in processing preribosomal RNA. It is associated with the U3, U8, and U13 small nuclear RNAs and is located in the dense fibrillar component (DFC) of the nucleolus. The encoded protein contains an N-terminal repetitive domain that is rich in glycine and arginine residues, like fibrillarins in other species. Its central region resembles an RNA-binding domain and contains an RNP consensus sequence. Antisera from approximately 8% of humans with the autoimmune disease scleroderma recognize fibrillarin. [provided by RefSeq, Jul 2008]
Mouse(14113) fibrillarin
Rat(292747) fibrillarin
sheep(101117097) fibrillarin
Zebrafish(406275) fibrillarin
cow(538548) fibrillarin
dog(476460) fibrillarin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1101099 Anti-FBL (126-140) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunofluorescence, western blot pricing
SAB2502092 Anti-FBL antibody produced in goat affinity isolated antibody, buffered aqueous solution pig, bovine, mouse, rat, human, canine
ELISA, western blot pricing
SAB2502093 Anti-FBL antibody produced in goat affinity isolated antibody, buffered aqueous solution mouse, human, bovine, pig, rat, canine
ELISA, western blot pricing
SAB2701663 Anti-fbl antibody produced in rabbit affinity isolated antibody, buffered aqueous solution zebrafish
immunohistochemistry, western blot pricing
SAB2701789 Anti-fbl antibody produced in rabbit affinity isolated antibody, buffered aqueous solution zebrafish
immunohistochemistry, western blot pricing
AV40366 Anti-FBL antibody produced in rabbit IgG fraction of antiserum mouse, horse, rabbit, canine, guinea pig, rat, bovine, human
immunohistochemistry, western blot pricing
HPA049546 Anti-FBL antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
SAB4300633 Anti-Fibrillarin antibody produced in rabbit affinity isolated antibody rat, human, mouse
western blot pricing
WH0002091M1 Monoclonal Anti-FBL antibody produced in mouse clone 4G9-E4, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1403793 Monoclonal Anti-FBL antibody produced in mouse clone 3E10, purified immunoglobulin, buffered aqueous solution human
ELISA pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007991 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007991 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007991 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001436 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001436 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001436 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001436 Rosetta Predictions human pricing
NM_001025643 Rosetta Predictions rat pricing
NM_007991 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001436 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00095018 predicted 673
2 SASI_Hs01_00095019 predicted 502
3 SASI_Hs01_00095020 predicted 653
4 SASI_Hs01_00095021 predicted 814
5 SASI_Hs01_00095022 predicted 826
6 SASI_Hs01_00095023 predicted 660
7 SASI_Hs01_00095024 predicted 741
8 SASI_Hs01_00095025 predicted 710
9 SASI_Hs01_00095026 predicted 810
10 SASI_Hs01_00095027 predicted 849
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025643 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00046658 predicted 476
2 SASI_Rn01_00046659 predicted 467
3 SASI_Rn01_00046660 predicted 857
4 SASI_Rn01_00046661 predicted 653
5 SASI_Rn02_00203216 predicted 445
6 SASI_Rn01_00046662 predicted 735
7 SASI_Rn01_00046664 predicted 846
8 SASI_Rn01_00046665 predicted 770
9 SASI_Rn01_00046666 predicted 885
10 SASI_Rn02_00203217 predicted 720
11 SASI_Rn01_00046663 predicted 842
12 SASI_Rn01_00046667 predicted 804
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007991 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00052183 predicted 375
2 SASI_Mm02_00312904 predicted 437
3 SASI_Mm01_00052187 predicted 303
4 SASI_Mm01_00052188 predicted 352
5 SASI_Mm01_00052192 predicted 348
6 SASI_Mm02_00312905 predicted 447
7 SASI_Mm02_00312906 predicted 429
8 SASI_Mm02_00312907 predicted 430
9 SASI_Mm02_00312908 predicted 731
10 SASI_Mm01_00052184 predicted 907
11 SASI_Mm01_00052185 predicted 566
12 SASI_Mm01_00052186 predicted 718
13 SASI_Mm01_00052189 predicted 699
14 SASI_Mm01_00052190 predicted 707
15 SASI_Mm01_00052191 predicted 700
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007991
VALIDATED
FBL MISSION shRNA Bacterial Glycerol Stock
fibrillarin
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000335739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007991.3-377s21c1
Sequence:CCGGCGCGGAAAGGAGGATGCCCTTCTCGAGAAGGGCATCCTCCTTTCCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007991.3-446s21c1
Sequence:CCGGGTCTCTATTTCAGAAGGAGATCTCGAGATCTCCTTCTGAAATAGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007991.3-676s21c1
Sequence:CCGGCCTCATCAACTTGGCCAAGAACTCGAGTTCTTGGCCAAGTTGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007991.3-689s21c1
Sequence:CCGGGCCAAGAAGAGGACTAACATTCTCGAGAATGTTAGTCCTCTTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007991.2-389s1c1
Sequence:CCGGCGCGGAAAGGAGGATGCCCTTCTCGAGAAGGGCATCCTCCTTTCCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007991.2-458s1c1
Sequence:CCGGGTCTCTATTTCAGAAGGAGATCTCGAGATCTCCTTCTGAAATAGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007991.2-749s1c1
Sequence:CCGGCCACACAAATACCGCATGCTTCTCGAGAAGCATGCGGTATTTGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007991.2-688s1c1
Sequence:CCGGCCTCATCAACTTGGCCAAGAACTCGAGTTCTTGGCCAAGTTGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007991.2-701s1c1
Sequence:CCGGGCCAAGAAGAGGACTAACATTCTCGAGAATGTTAGTCCTCTTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007991
VALIDATED
FBL MISSION shRNA shRNA Plasmid DNA
fibrillarin
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000335739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007991.3-377s21c1
Sequence:CCGGCGCGGAAAGGAGGATGCCCTTCTCGAGAAGGGCATCCTCCTTTCCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007991.3-446s21c1
Sequence:CCGGGTCTCTATTTCAGAAGGAGATCTCGAGATCTCCTTCTGAAATAGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007991.3-676s21c1
Sequence:CCGGCCTCATCAACTTGGCCAAGAACTCGAGTTCTTGGCCAAGTTGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007991.3-689s21c1
Sequence:CCGGGCCAAGAAGAGGACTAACATTCTCGAGAATGTTAGTCCTCTTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007991.2-389s1c1
Sequence:CCGGCGCGGAAAGGAGGATGCCCTTCTCGAGAAGGGCATCCTCCTTTCCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007991.2-458s1c1
Sequence:CCGGGTCTCTATTTCAGAAGGAGATCTCGAGATCTCCTTCTGAAATAGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007991.2-749s1c1
Sequence:CCGGCCACACAAATACCGCATGCTTCTCGAGAAGCATGCGGTATTTGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007991.2-688s1c1
Sequence:CCGGCCTCATCAACTTGGCCAAGAACTCGAGTTCTTGGCCAAGTTGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007991.2-701s1c1
Sequence:CCGGGCCAAGAAGAGGACTAACATTCTCGAGAATGTTAGTCCTCTTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007991
VALIDATED
FBL MISSION shRNA Lentiviral Transduction Particles
fibrillarin
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000335739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007991.3-377s21c1
Sequence:CCGGCGCGGAAAGGAGGATGCCCTTCTCGAGAAGGGCATCCTCCTTTCCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007991.3-446s21c1
Sequence:CCGGGTCTCTATTTCAGAAGGAGATCTCGAGATCTCCTTCTGAAATAGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007991.3-676s21c1
Sequence:CCGGCCTCATCAACTTGGCCAAGAACTCGAGTTCTTGGCCAAGTTGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007991.3-689s21c1
Sequence:CCGGGCCAAGAAGAGGACTAACATTCTCGAGAATGTTAGTCCTCTTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007991.2-389s1c1
Sequence:CCGGCGCGGAAAGGAGGATGCCCTTCTCGAGAAGGGCATCCTCCTTTCCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007991.2-458s1c1
Sequence:CCGGGTCTCTATTTCAGAAGGAGATCTCGAGATCTCCTTCTGAAATAGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007991.2-749s1c1
Sequence:CCGGCCACACAAATACCGCATGCTTCTCGAGAAGCATGCGGTATTTGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007991.2-688s1c1
Sequence:CCGGCCTCATCAACTTGGCCAAGAACTCGAGTTCTTGGCCAAGTTGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007991.2-701s1c1
Sequence:CCGGGCCAAGAAGAGGACTAACATTCTCGAGAATGTTAGTCCTCTTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001436
VALIDATED
FBL MISSION shRNA Bacterial Glycerol Stock
fibrillarin
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000292352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001436.3-796s21c1
Sequence:CCGGGCAATGGTGGATGTGATCTTTCTCGAGAAAGATCACATCCACCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_001436.3-486s21c1
Sequence:CCGGGATTTCGGAAGGAGATGACAACTCGAGTTGTCATCTCCTTCCGAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001436.3-735s21c1
Sequence:CCGGGACCAACATCATTCCTGTGATCTCGAGATCACAGGAATGATGTTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_001436.3-1008s21c1
Sequence:CCGGCCTTGAGCCATATGAAAGAGACTCGAGTCTCTTTCATATGGCTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001436.2-339s1c1
Sequence:CCGGGAGGGTGTCTTCATTTGTCGACTCGAGTCGACAAATGAAGACACCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001436.2-426s1c1
Sequence:CCGGGTCTCGATTTCGGAAGGAGATCTCGAGATCTCCTTCCGAAATCGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001436.2-953s1c1
Sequence:CCGGCCTTGAGCCATATGAAAGAGACTCGAGTCTCTTTCATATGGCTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001436.2-957s1c1
Sequence:CCGGGAGCCATATGAAAGAGACCATCTCGAGATGGTCTCTTTCATATGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001436.2-431s1c1
Sequence:CCGGGATTTCGGAAGGAGATGACAACTCGAGTTGTCATCTCCTTCCGAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001436.2-832s1c1
Sequence:CCGGGACACTTTGTGATTTCCATTACTCGAGTAATGGAAATCACAAAGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001436.2-741s1c1
Sequence:CCGGGCAATGGTGGATGTGATCTTTCTCGAGAAAGATCACATCCACCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001436.2-680s1c1
Sequence:CCGGGACCAACATCATTCCTGTGATCTCGAGATCACAGGAATGATGTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001436.2-671s1c1
Sequence:CCGGCAAGAAGAGGACCAACATCATCTCGAGATGATGTTGGTCCTCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162993    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001436.2-513s1c1
Sequence:CCGGGTGGACCAGATCCACATCAAACTCGAGTTTGATGTGGATCTGGTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001436
VALIDATED
FBL MISSION shRNA shRNA Plasmid DNA
fibrillarin
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000292352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001436.3-796s21c1
Sequence:CCGGGCAATGGTGGATGTGATCTTTCTCGAGAAAGATCACATCCACCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_001436.3-486s21c1
Sequence:CCGGGATTTCGGAAGGAGATGACAACTCGAGTTGTCATCTCCTTCCGAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001436.3-735s21c1
Sequence:CCGGGACCAACATCATTCCTGTGATCTCGAGATCACAGGAATGATGTTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_001436.3-1008s21c1
Sequence:CCGGCCTTGAGCCATATGAAAGAGACTCGAGTCTCTTTCATATGGCTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001436.2-339s1c1
Sequence:CCGGGAGGGTGTCTTCATTTGTCGACTCGAGTCGACAAATGAAGACACCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001436.2-426s1c1
Sequence:CCGGGTCTCGATTTCGGAAGGAGATCTCGAGATCTCCTTCCGAAATCGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001436.2-953s1c1
Sequence:CCGGCCTTGAGCCATATGAAAGAGACTCGAGTCTCTTTCATATGGCTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001436.2-957s1c1
Sequence:CCGGGAGCCATATGAAAGAGACCATCTCGAGATGGTCTCTTTCATATGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001436.2-431s1c1
Sequence:CCGGGATTTCGGAAGGAGATGACAACTCGAGTTGTCATCTCCTTCCGAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001436.2-832s1c1
Sequence:CCGGGACACTTTGTGATTTCCATTACTCGAGTAATGGAAATCACAAAGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001436.2-741s1c1
Sequence:CCGGGCAATGGTGGATGTGATCTTTCTCGAGAAAGATCACATCCACCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001436.2-680s1c1
Sequence:CCGGGACCAACATCATTCCTGTGATCTCGAGATCACAGGAATGATGTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001436.2-671s1c1
Sequence:CCGGCAAGAAGAGGACCAACATCATCTCGAGATGATGTTGGTCCTCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162993    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001436.2-513s1c1
Sequence:CCGGGTGGACCAGATCCACATCAAACTCGAGTTTGATGTGGATCTGGTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001436
VALIDATED
FBL MISSION shRNA Lentiviral Transduction Particles
fibrillarin
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000292352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001436.3-796s21c1
Sequence:CCGGGCAATGGTGGATGTGATCTTTCTCGAGAAAGATCACATCCACCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_001436.3-486s21c1
Sequence:CCGGGATTTCGGAAGGAGATGACAACTCGAGTTGTCATCTCCTTCCGAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001436.3-735s21c1
Sequence:CCGGGACCAACATCATTCCTGTGATCTCGAGATCACAGGAATGATGTTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_001436.3-1008s21c1
Sequence:CCGGCCTTGAGCCATATGAAAGAGACTCGAGTCTCTTTCATATGGCTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001436.2-339s1c1
Sequence:CCGGGAGGGTGTCTTCATTTGTCGACTCGAGTCGACAAATGAAGACACCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001436.2-426s1c1
Sequence:CCGGGTCTCGATTTCGGAAGGAGATCTCGAGATCTCCTTCCGAAATCGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001436.2-953s1c1
Sequence:CCGGCCTTGAGCCATATGAAAGAGACTCGAGTCTCTTTCATATGGCTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001436.2-957s1c1
Sequence:CCGGGAGCCATATGAAAGAGACCATCTCGAGATGGTCTCTTTCATATGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001436.2-431s1c1
Sequence:CCGGGATTTCGGAAGGAGATGACAACTCGAGTTGTCATCTCCTTCCGAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001436.2-832s1c1
Sequence:CCGGGACACTTTGTGATTTCCATTACTCGAGTAATGGAAATCACAAAGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001436.2-741s1c1
Sequence:CCGGGCAATGGTGGATGTGATCTTTCTCGAGAAAGATCACATCCACCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001436.2-680s1c1
Sequence:CCGGGACCAACATCATTCCTGTGATCTCGAGATCACAGGAATGATGTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001436.2-671s1c1
Sequence:CCGGCAAGAAGAGGACCAACATCATCTCGAGATGATGTTGGTCCTCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162993    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001436.2-513s1c1
Sequence:CCGGGTGGACCAGATCCACATCAAACTCGAGTTTGATGTGGATCTGGTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks