EMAIL THIS PAGE TO A FRIEND

FBLIM1

filamin binding LIM protein 1

81 Gene Product Result for
Synonyms: CAL FBLP-1 FBLP1
Gene ID:
Human(54751) Summary: This gene encodes a protein with an N-terminal filamin-binding domain, a central proline-rich domain, and, multiple C-terminal LIM domains. This protein localizes at cell junctions and may link cell adhesion structures to the actin cytoskeleton. This protein may be involved in the assembly and stabilization of actin-filaments and likely plays a role in modulating cell adhesion, cell morphology and cell motility. This protein also localizes to the nucleus and may affect cardiomyocyte differentiation after binding with the CSX/NKX2-5 transcription factor. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Mouse(74202) filamin binding LIM protein 1
Rat(362650) filamin binding LIM protein 1
sheep(101109631) filamin binding LIM protein 1
domestic guinea pig(100731846) filamin binding LIM protein 1
naked mole-rat(101709740) filamin binding LIM protein 1
chicken(419458) filamin binding LIM protein 1
dog(608618) filamin binding LIM protein 1
domestic cat(101082251) filamin binding LIM protein 1
cow(767833) filamin binding LIM protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133754 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133754 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133754 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017556 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017556 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017556 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001024215 Rosetta Predictions human pricing
NM_001024216 Rosetta Predictions human pricing
NM_017556 Rosetta Predictions human pricing
NM_001007554 Rosetta Predictions rat pricing
NM_133754 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024215 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00085223 predicted 410
2 SASI_Hs01_00085225 predicted 817
3 SASI_Hs01_00085226 predicted 230
4 SASI_Hs02_00307115 predicted 785
5 SASI_Hs01_00085227 predicted 428
6 SASI_Hs01_00085228 predicted 712
7 SASI_Hs01_00085229 predicted 868
8 SASI_Hs01_00085230 predicted 425
9 SASI_Hs01_00085231 predicted 579
10 SASI_Hs01_00085232 predicted 290
11 SASI_Hs01_00085224 predicted 213
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024216 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00307116 predicted 653
2 SASI_Hs01_00113248 predicted 446
3 SASI_Hs01_00113249 predicted 1198
4 SASI_Hs01_00113250 predicted 226
5 SASI_Hs01_00113251 predicted 338
6 SASI_Hs01_00113252 predicted 245
7 SASI_Hs01_00113253 predicted 383
8 SASI_Hs01_00113254 predicted 437
9 SASI_Hs01_00113247 predicted 695
10 SASI_Hs01_00113255 predicted 424
11 SASI_Hs01_00113256 predicted 107
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017556 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00350201 predicted 1226
2 SASI_Hs01_00181973 predicted 1011
3 SASI_Hs01_00181974 predicted 1773
4 SASI_Hs01_00181976 predicted 912
5 SASI_Hs01_00181977 predicted 807
6 SASI_Hs02_00350202 predicted 1007
7 SASI_Hs01_00181979 predicted 524
8 SASI_Hs01_00181972 predicted 1261
9 SASI_Hs01_00181980 predicted 676
10 SASI_Hs01_00181981 predicted 995
11 SASI_Hs01_00181975 predicted 510
12 SASI_Hs01_00181978 predicted 967
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007554 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00068693 predicted 767
2 SASI_Rn02_00198650 predicted 777
3 SASI_Rn01_00068694 predicted 836
4 SASI_Rn01_00068695 predicted 779
5 SASI_Rn02_00198651 predicted 995
6 SASI_Rn01_00068696 predicted 1233
7 SASI_Rn01_00068698 predicted 471
8 SASI_Rn01_00068699 predicted 1133
9 SASI_Rn02_00198652 predicted 553
10 SASI_Rn01_00068700 predicted 1080
11 SASI_Rn01_00068697 predicted 206
12 SASI_Rn01_00068701 predicted 1023
13 SASI_Rn01_00068702 predicted 433
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133754 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00034537 predicted 1150
2 SASI_Mm01_00034538 predicted 1400
3 SASI_Mm01_00034539 predicted 532
4 SASI_Mm01_00034540 predicted 715
5 SASI_Mm01_00034542 predicted 1386
6 SASI_Mm01_00034543 predicted 1521
7 SASI_Mm01_00034545 predicted 234
8 SASI_Mm02_00338739 predicted 841
9 SASI_Mm02_00338740 predicted 439
10 SASI_Mm01_00034546 predicted 1645
11 SASI_Mm01_00034541 predicted 262
12 SASI_Mm01_00034544 predicted 666
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133754
VALIDATED
FBLIM1 MISSION shRNA Bacterial Glycerol Stock
filamin binding LIM protein 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000098755    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133754.2-1941s1c1
Sequence:CCGGCCAGAGTTCATTTCCCAGCATCTCGAGATGCTGGGAAATGAACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133754.2-1017s1c1
Sequence:CCGGTGGCTGATTTCTACAGGAAATCTCGAGATTTCCTGTAGAAATCAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133754.2-803s1c1
Sequence:CCGGCAGAGATTCTACCAGAAGGATCTCGAGATCCTTCTGGTAGAATCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133754.2-481s1c1
Sequence:CCGGGCCTCCTGTCTTACCAGGGAACTCGAGTTCCCTGGTAAGACAGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133754.2-1019s1c1
Sequence:CCGGGCTGATTTCTACAGGAAATTTCTCGAGAAATTTCCTGTAGAAATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133754.4-842s21c1
Sequence:CCGGCAGAGATTCTACCAGAAGGATCTCGAGATCCTTCTGGTAGAATCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133754.4-1058s21c1
Sequence:CCGGGCTGATTTCTACAGGAAATTTCTCGAGAAATTTCCTGTAGAAATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133754.4-608s21c1
Sequence:CCGGCCATCAAAGGGATCGTCTGTCCTCGAGGACAGACGATCCCTTTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133754.4-1086s21c1
Sequence:CCGGTGTGCAGCATCTGCGAGAATCCTCGAGGATTCTCGCAGATGCTGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295097    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133754.4-1553s21c1
Sequence:CCGGGTGCTGCCCTGACATGTTTATCTCGAGATAAACATGTCAGGGCAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133754
VALIDATED
FBLIM1 MISSION shRNA shRNA Plasmid DNA
filamin binding LIM protein 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000098755    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133754.2-1941s1c1
Sequence:CCGGCCAGAGTTCATTTCCCAGCATCTCGAGATGCTGGGAAATGAACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133754.2-1017s1c1
Sequence:CCGGTGGCTGATTTCTACAGGAAATCTCGAGATTTCCTGTAGAAATCAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133754.2-803s1c1
Sequence:CCGGCAGAGATTCTACCAGAAGGATCTCGAGATCCTTCTGGTAGAATCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133754.2-481s1c1
Sequence:CCGGGCCTCCTGTCTTACCAGGGAACTCGAGTTCCCTGGTAAGACAGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133754.2-1019s1c1
Sequence:CCGGGCTGATTTCTACAGGAAATTTCTCGAGAAATTTCCTGTAGAAATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133754.4-842s21c1
Sequence:CCGGCAGAGATTCTACCAGAAGGATCTCGAGATCCTTCTGGTAGAATCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133754.4-1058s21c1
Sequence:CCGGGCTGATTTCTACAGGAAATTTCTCGAGAAATTTCCTGTAGAAATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133754.4-608s21c1
Sequence:CCGGCCATCAAAGGGATCGTCTGTCCTCGAGGACAGACGATCCCTTTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133754.4-1086s21c1
Sequence:CCGGTGTGCAGCATCTGCGAGAATCCTCGAGGATTCTCGCAGATGCTGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295097    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133754.4-1553s21c1
Sequence:CCGGGTGCTGCCCTGACATGTTTATCTCGAGATAAACATGTCAGGGCAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133754
VALIDATED
FBLIM1 MISSION shRNA Lentiviral Transduction Particles
filamin binding LIM protein 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000098755    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133754.2-1941s1c1
Sequence:CCGGCCAGAGTTCATTTCCCAGCATCTCGAGATGCTGGGAAATGAACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133754.2-1017s1c1
Sequence:CCGGTGGCTGATTTCTACAGGAAATCTCGAGATTTCCTGTAGAAATCAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133754.2-803s1c1
Sequence:CCGGCAGAGATTCTACCAGAAGGATCTCGAGATCCTTCTGGTAGAATCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133754.2-481s1c1
Sequence:CCGGGCCTCCTGTCTTACCAGGGAACTCGAGTTCCCTGGTAAGACAGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133754.2-1019s1c1
Sequence:CCGGGCTGATTTCTACAGGAAATTTCTCGAGAAATTTCCTGTAGAAATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133754.4-842s21c1
Sequence:CCGGCAGAGATTCTACCAGAAGGATCTCGAGATCCTTCTGGTAGAATCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133754.4-1058s21c1
Sequence:CCGGGCTGATTTCTACAGGAAATTTCTCGAGAAATTTCCTGTAGAAATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133754.4-608s21c1
Sequence:CCGGCCATCAAAGGGATCGTCTGTCCTCGAGGACAGACGATCCCTTTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133754.4-1086s21c1
Sequence:CCGGTGTGCAGCATCTGCGAGAATCCTCGAGGATTCTCGCAGATGCTGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295097    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133754.4-1553s21c1
Sequence:CCGGGTGCTGCCCTGACATGTTTATCTCGAGATAAACATGTCAGGGCAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017556
FBLIM1 MISSION shRNA Bacterial Glycerol Stock
filamin binding LIM protein 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149805    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017556.2-2982s1c1
Sequence:CCGGGCACGGACAAGTTAAACAGAACTCGAGTTCTGTTTAACTTGTCCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146787    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017556.2-2928s1c1
Sequence:CCGGCCTTTGAAGGAGAATCATCATCTCGAGATGATGATTCTCCTTCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017556.2-680s1c1
Sequence:CCGGCTCACTCATTGCAGACTTAGACTCGAGTCTAAGTCTGCAATGAGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017556.1-1505s1c1
Sequence:CCGGGAACAACCATCTCTTCTGCAACTCGAGTTGCAGAAGAGATGGTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017556.2-680s21c1
Sequence:CCGGCTCACTCATTGCAGACTTAGACTCGAGTCTAAGTCTGCAATGAGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017556.2-1361s21c1
Sequence:CCGGGAACAACCATCTCTTCTGCAACTCGAGTTGCAGAAGAGATGGTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319339    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017556.2-2982s21c1
Sequence:CCGGGCACGGACAAGTTAAACAGAACTCGAGTTCTGTTTAACTTGTCCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319338    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017556.2-2928s21c1
Sequence:CCGGCCTTTGAAGGAGAATCATCATCTCGAGATGATGATTCTCCTTCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017556
FBLIM1 MISSION shRNA shRNA Plasmid DNA
filamin binding LIM protein 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149805    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017556.2-2982s1c1
Sequence:CCGGGCACGGACAAGTTAAACAGAACTCGAGTTCTGTTTAACTTGTCCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146787    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017556.2-2928s1c1
Sequence:CCGGCCTTTGAAGGAGAATCATCATCTCGAGATGATGATTCTCCTTCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017556.2-680s1c1
Sequence:CCGGCTCACTCATTGCAGACTTAGACTCGAGTCTAAGTCTGCAATGAGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017556.1-1505s1c1
Sequence:CCGGGAACAACCATCTCTTCTGCAACTCGAGTTGCAGAAGAGATGGTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017556.2-680s21c1
Sequence:CCGGCTCACTCATTGCAGACTTAGACTCGAGTCTAAGTCTGCAATGAGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017556.2-1361s21c1
Sequence:CCGGGAACAACCATCTCTTCTGCAACTCGAGTTGCAGAAGAGATGGTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319339    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017556.2-2982s21c1
Sequence:CCGGGCACGGACAAGTTAAACAGAACTCGAGTTCTGTTTAACTTGTCCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319338    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017556.2-2928s21c1
Sequence:CCGGCCTTTGAAGGAGAATCATCATCTCGAGATGATGATTCTCCTTCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017556
FBLIM1 MISSION shRNA Lentiviral Transduction Particles
filamin binding LIM protein 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149805    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017556.2-2982s1c1
Sequence:CCGGGCACGGACAAGTTAAACAGAACTCGAGTTCTGTTTAACTTGTCCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146787    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017556.2-2928s1c1
Sequence:CCGGCCTTTGAAGGAGAATCATCATCTCGAGATGATGATTCTCCTTCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017556.2-680s1c1
Sequence:CCGGCTCACTCATTGCAGACTTAGACTCGAGTCTAAGTCTGCAATGAGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017556.1-1505s1c1
Sequence:CCGGGAACAACCATCTCTTCTGCAACTCGAGTTGCAGAAGAGATGGTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017556.2-680s21c1
Sequence:CCGGCTCACTCATTGCAGACTTAGACTCGAGTCTAAGTCTGCAATGAGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017556.2-1361s21c1
Sequence:CCGGGAACAACCATCTCTTCTGCAACTCGAGTTGCAGAAGAGATGGTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319339    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017556.2-2982s21c1
Sequence:CCGGGCACGGACAAGTTAAACAGAACTCGAGTTCTGTTTAACTTGTCCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319338    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017556.2-2928s21c1
Sequence:CCGGCCTTTGAAGGAGAATCATCATCTCGAGATGATGATTCTCCTTCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks