EMAIL THIS PAGE TO A FRIEND

FBLL1

fibrillarin-like 1

61 Gene Product Result for
UniProtKB ID: A6NHQ2
Gene ID:
Mouse(237730) fibrillarin-like 1
Rat(363563) fibrillarin-like 1
naked mole-rat(101711578) fibrillarin-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_001722529 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_001722529 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_001722529 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001004147 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001004147 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001004147 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU065121 MISSION® esiRNA esiRNA targeting mouse Fbll1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001722529 Rosetta Predictions human pricing
XM_001725347 Rosetta Predictions human pricing
XM_293903 Rosetta Predictions human pricing
NM_001108824 Rosetta Predictions rat pricing
NM_001004147 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001722529 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00449738 predicted 271
2 SASI_Hs02_00449739 predicted 358
3 SASI_Hs02_00449740 predicted 527
4 SASI_Hs02_00449741 predicted 358
5 SASI_Hs02_00449742 predicted 214
6 SASI_Hs02_00449743 predicted 228
7 SASI_Hs02_00449744 predicted 374
8 SASI_Hs02_00449745 predicted 303
9 SASI_Hs02_00449746 predicted 405
10 SASI_Hs02_00449747 predicted 424
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001725347 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00467118 predicted 270
2 SASI_Hs02_00467119 predicted 363
3 SASI_Hs02_00467120 predicted 523
4 SASI_Hs02_00467121 predicted 360
5 SASI_Hs02_00467122 predicted 209
6 SASI_Hs02_00467123 predicted 230
7 SASI_Hs02_00467124 predicted 374
8 SASI_Hs02_00467125 predicted 301
9 SASI_Hs02_00467126 predicted 409
10 SASI_Hs02_00467127 predicted 420
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_293903 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00270061 predicted 551
2 SASI_Hs01_00270062 predicted 642
3 SASI_Hs01_00270063 predicted 808
4 SASI_Hs01_00270064 predicted 644
5 SASI_Hs01_00270065 predicted 493
6 SASI_Hs02_00479178 predicted 506
7 SASI_Hs01_00270066 predicted 646
8 SASI_Hs01_00270067 predicted 586
9 SASI_Hs01_00270069 predicted 692
10 SASI_Hs01_00270070 predicted 706
11 SASI_Hs01_00270068 predicted 699
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108824 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00242435 predicted 999
2 SASI_Rn02_00242436 predicted 1181
3 SASI_Rn02_00242437 predicted 1056
4 SASI_Rn02_00242438 predicted 897
5 SASI_Rn02_00242439 predicted 1063
6 SASI_Rn02_00242440 predicted 1053
7 SASI_Rn02_00242441 predicted 1049
8 SASI_Rn02_00242442 predicted 1110
9 SASI_Rn02_00242443 predicted 1329
10 SASI_Rn02_00242444 predicted 1094
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004147 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00020166 predicted 1166
2 SASI_Mm01_00020167 predicted 1172
3 SASI_Mm02_00286458 predicted 842
4 SASI_Mm02_00286459 predicted 946
5 SASI_Mm01_00020169 predicted 1084
6 SASI_Mm01_00020170 predicted 1047
7 SASI_Mm02_00286460 predicted 951
8 SASI_Mm01_00020171 predicted 944
9 SASI_Mm01_00020172 predicted 934
10 SASI_Mm01_00020173 predicted 1102
11 SASI_Mm01_00020168 predicted 956
12 SASI_Mm01_00020174 predicted 675
13 SASI_Mm01_00020175 predicted 811
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_001722529
FBLL1 MISSION shRNA Bacterial Glycerol Stock
fibrillarin-like 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000239352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001722529.1-611s21c1
Sequence:CCGGTTGCAGCAGGAGAACTTGAAGCTCGAGCTTCAAGTTCTCCTGCTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001722529.1-529s21c1
Sequence:CCGGCCACTTTCTCATCTCCATCAACTCGAGTTGATGGAGATGAGAAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001722529.1-216s21c1
Sequence:CCGGAGATCCACATCAAGCCCAAGTCTCGAGACTTGGGCTTGATGTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001722529.1-352s21c1
Sequence:CCGGTCTGGTCAACGTGGCCAAGAACTCGAGTTCTTGGCCACGTTGACCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001722529.1-277s21c1
Sequence:CCGGCTCCCATGTCTCCGACATCATCTCGAGATGATGTCGGAGACATGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_001722529
FBLL1 MISSION shRNA shRNA Plasmid DNA
fibrillarin-like 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000239352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001722529.1-611s21c1
Sequence:CCGGTTGCAGCAGGAGAACTTGAAGCTCGAGCTTCAAGTTCTCCTGCTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001722529.1-529s21c1
Sequence:CCGGCCACTTTCTCATCTCCATCAACTCGAGTTGATGGAGATGAGAAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001722529.1-216s21c1
Sequence:CCGGAGATCCACATCAAGCCCAAGTCTCGAGACTTGGGCTTGATGTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001722529.1-352s21c1
Sequence:CCGGTCTGGTCAACGTGGCCAAGAACTCGAGTTCTTGGCCACGTTGACCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001722529.1-277s21c1
Sequence:CCGGCTCCCATGTCTCCGACATCATCTCGAGATGATGTCGGAGACATGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_001722529
FBLL1 MISSION shRNA Lentiviral Transduction Particles
fibrillarin-like 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000239352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001722529.1-611s21c1
Sequence:CCGGTTGCAGCAGGAGAACTTGAAGCTCGAGCTTCAAGTTCTCCTGCTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001722529.1-529s21c1
Sequence:CCGGCCACTTTCTCATCTCCATCAACTCGAGTTGATGGAGATGAGAAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001722529.1-216s21c1
Sequence:CCGGAGATCCACATCAAGCCCAAGTCTCGAGACTTGGGCTTGATGTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001722529.1-352s21c1
Sequence:CCGGTCTGGTCAACGTGGCCAAGAACTCGAGTTCTTGGCCACGTTGACCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001722529.1-277s21c1
Sequence:CCGGCTCCCATGTCTCCGACATCATCTCGAGATGATGTCGGAGACATGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001004147
FBLL1 MISSION shRNA Bacterial Glycerol Stock
fibrillarin-like 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000097584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004147.1-677s1c1
Sequence:CCGGCCTGGTCTATGCGGTTGAATTCTCGAGAATTCAACCGCATAGACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004147.1-981s1c1
Sequence:CCGGCAACAGGAGAACTTGAAGCCACTCGAGTGGCTTCAAGTTCTCCTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004147.1-836s1c1
Sequence:CCGGCCAGCCAGATCAGTCGCGCATCTCGAGATGCGCGACTGATCTGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004147.1-782s1c1
Sequence:CCGGGCTCAAGTATCGCATGCTCATCTCGAGATGAGCATGCGATACTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004147.1-596s1c1
Sequence:CCGGGCCCAAGTCCAAAGTGTTGTACTCGAGTACAACACTTTGGACTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001004147
FBLL1 MISSION shRNA shRNA Plasmid DNA
fibrillarin-like 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000097584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004147.1-677s1c1
Sequence:CCGGCCTGGTCTATGCGGTTGAATTCTCGAGAATTCAACCGCATAGACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004147.1-981s1c1
Sequence:CCGGCAACAGGAGAACTTGAAGCCACTCGAGTGGCTTCAAGTTCTCCTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004147.1-836s1c1
Sequence:CCGGCCAGCCAGATCAGTCGCGCATCTCGAGATGCGCGACTGATCTGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004147.1-782s1c1
Sequence:CCGGGCTCAAGTATCGCATGCTCATCTCGAGATGAGCATGCGATACTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004147.1-596s1c1
Sequence:CCGGGCCCAAGTCCAAAGTGTTGTACTCGAGTACAACACTTTGGACTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001004147
FBLL1 MISSION shRNA Lentiviral Transduction Particles
fibrillarin-like 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000097584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004147.1-677s1c1
Sequence:CCGGCCTGGTCTATGCGGTTGAATTCTCGAGAATTCAACCGCATAGACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004147.1-981s1c1
Sequence:CCGGCAACAGGAGAACTTGAAGCCACTCGAGTGGCTTCAAGTTCTCCTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004147.1-836s1c1
Sequence:CCGGCCAGCCAGATCAGTCGCGCATCTCGAGATGCGCGACTGATCTGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004147.1-782s1c1
Sequence:CCGGGCTCAAGTATCGCATGCTCATCTCGAGATGAGCATGCGATACTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004147.1-596s1c1
Sequence:CCGGGCCCAAGTCCAAAGTGTTGTACTCGAGTACAACACTTTGGACTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks