EMAIL THIS PAGE TO A FRIEND

FBLN1

fibulin 1

116 Gene Product Result for
Synonyms: FBLN FIBL1
Gene ID:
Human(2192) Summary: Fibulin 1 is a secreted glycoprotein that becomes incorporated into a fibrillar extracellular matrix. Calcium-binding is apparently required to mediate its binding to laminin and nidogen. It mediates platelet adhesion via binding fibrinogen. Four splice variants which differ in the 3' end have been identified. Each variant encodes a different isoform, but no functional distinctions have been identified among the four variants. [provided by RefSeq, Jul 2008]
Mouse(14114) fibulin 1
Rat(315191) fibulin 1
Zebrafish(30240) fibulin 1
cow(514588) fibulin 1
dog(474468) fibulin 1
chicken(373979) fibulin 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0502 AQUA Peptide GYHLNEEGT[R] human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010180 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010180 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010180 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001996 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001996 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001996 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001996 Rosetta Predictions human pricing
NM_006485 Rosetta Predictions human pricing
NM_006486 Rosetta Predictions human pricing
NM_006487 Rosetta Predictions human pricing
NM_001127547 Rosetta Predictions rat pricing
NM_010180 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001996 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00209942 predicted 1020
2 SASI_Hs02_00332985 predicted 1144
3 SASI_Hs01_00209944 predicted 649
4 SASI_Hs01_00209945 predicted 1614
5 SASI_Hs02_00332986 predicted 1020
6 SASI_Hs01_00209947 predicted 1156
7 SASI_Hs01_00209948 predicted 913
8 SASI_Hs02_00332987 predicted 652
9 SASI_Hs01_00209949 predicted 1287
10 SASI_Hs02_00332988 predicted 1449
11 SASI_Hs01_00209940 predicted 1334
12 SASI_Hs01_00209941 predicted 1062
13 SASI_Hs01_00209943 predicted 536
14 SASI_Hs01_00209946 predicted 897
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006485 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00207303 predicted 1023
2 SASI_Hs02_00341670 predicted 1139
3 SASI_Hs01_00207305 predicted 655
4 SASI_Hs01_00207306 predicted 1615
5 SASI_Hs02_00341671 predicted 1015
6 SASI_Hs01_00207308 predicted 1159
7 SASI_Hs01_00207309 predicted 919
8 SASI_Hs02_00341672 predicted 648
9 SASI_Hs01_00207310 predicted 1288
10 SASI_Hs02_00341673 predicted 1449
11 SASI_Hs01_00207301 predicted 1335
12 SASI_Hs01_00207302 predicted 1062
13 SASI_Hs01_00207304 predicted 529
14 SASI_Hs01_00207307 predicted 901
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006486 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00133276 predicted 1025
2 SASI_Hs02_00341674 predicted 1144
3 SASI_Hs01_00133278 predicted 648
4 SASI_Hs01_00133279 predicted 1614
5 SASI_Hs02_00341675 predicted 1019
6 SASI_Hs01_00133281 predicted 1155
7 SASI_Hs01_00133282 predicted 922
8 SASI_Hs02_00341676 predicted 651
9 SASI_Hs01_00133283 predicted 1288
10 SASI_Hs02_00341677 predicted 1449
11 SASI_Hs01_00133274 predicted 1326
12 SASI_Hs01_00133275 predicted 1062
13 SASI_Hs01_00133277 predicted 537
14 SASI_Hs01_00133280 predicted 894
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006487 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00175756 predicted 1025
2 SASI_Hs02_00341678 predicted 1145
3 SASI_Hs01_00175758 predicted 651
4 SASI_Hs01_00175759 predicted 1614
5 SASI_Hs02_00341679 predicted 1023
6 SASI_Hs01_00175761 predicted 1154
7 SASI_Hs01_00175762 predicted 917
8 SASI_Hs02_00341680 predicted 653
9 SASI_Hs01_00175763 predicted 1292
10 SASI_Hs02_00341681 predicted 1449
11 SASI_Hs01_00175754 predicted 1333
12 SASI_Hs01_00175755 predicted 1055
13 SASI_Hs01_00175757 predicted 529
14 SASI_Hs01_00175760 predicted 901
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127547 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00254223 predicted 2200
2 SASI_Rn02_00254224 predicted 1525
3 SASI_Rn02_00254225 predicted 1493
4 SASI_Rn02_00254226 predicted 895
5 SASI_Rn02_00254227 predicted 1044
6 SASI_Rn02_00254228 predicted 1013
7 SASI_Rn02_00254229 predicted 1151
8 SASI_Rn02_00254230 predicted 1600
9 SASI_Rn02_00254231 predicted 633
10 SASI_Rn02_00254232 predicted 359
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010180 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00045184 predicted 505
2 SASI_Mm01_00045185 predicted 639
3 SASI_Mm01_00045186 predicted 1655
4 SASI_Mm01_00045187 predicted 811
5 SASI_Mm01_00045188 predicted 1156
6 SASI_Mm01_00045189 predicted 575
7 SASI_Mm01_00045190 predicted 1050
8 SASI_Mm01_00045191 predicted 1530
9 SASI_Mm01_00045192 predicted 2046
10 SASI_Mm01_00045193 predicted 1512
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010180
VALIDATED
FBLN1 MISSION shRNA Bacterial Glycerol Stock
fibulin 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000109655    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010180.1-2322s1c1
Sequence:CCGGCCTCCCTTGATGTTTCATATTCTCGAGAATATGAAACATCAAGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010180.1-2049s1c1
Sequence:CCGGCCTTCGAGACTCCTTTGATATCTCGAGATATCAAAGGAGTCTCGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010180.1-2154s1c1
Sequence:CCGGGCTGGAGATGAACTACGTGTTCTCGAGAACACGTAGTTCATCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010180.1-895s1c1
Sequence:CCGGGAGGATAATAACTGCAAAGATCTCGAGATCTTTGCAGTTATTATCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010180.1-236s1c1
Sequence:CCGGCGGATCCAAATCAGATGGCTACTCGAGTAGCCATCTGATTTGGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010180.2-819s21c1
Sequence:CCGGGGGAGAATCCTGCATCAATACCTCGAGGTATTGATGCAGGATTCTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010180.2-1038s21c1
Sequence:CCGGTCTAGGCAACTGCATTGATATCTCGAGATATCAATGCAGTTGCCTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010180.2-426s21c1
Sequence:CCGGCCTTGAGACCATCTTCATAAACTCGAGTTTATGAAGATGGTCTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010180.2-762s21c1
Sequence:CCGGTGGTGTCTCCTGCGAAGATATCTCGAGATATCTTCGCAGGAGACACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010180.2-927s21c1
Sequence:CCGGATGTGAGACTGGTATTCATAACTCGAGTTATGAATACCAGTCTCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010180
VALIDATED
FBLN1 MISSION shRNA shRNA Plasmid DNA
fibulin 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000109655    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010180.1-2322s1c1
Sequence:CCGGCCTCCCTTGATGTTTCATATTCTCGAGAATATGAAACATCAAGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010180.1-2049s1c1
Sequence:CCGGCCTTCGAGACTCCTTTGATATCTCGAGATATCAAAGGAGTCTCGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010180.1-2154s1c1
Sequence:CCGGGCTGGAGATGAACTACGTGTTCTCGAGAACACGTAGTTCATCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010180.1-895s1c1
Sequence:CCGGGAGGATAATAACTGCAAAGATCTCGAGATCTTTGCAGTTATTATCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010180.1-236s1c1
Sequence:CCGGCGGATCCAAATCAGATGGCTACTCGAGTAGCCATCTGATTTGGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010180.2-819s21c1
Sequence:CCGGGGGAGAATCCTGCATCAATACCTCGAGGTATTGATGCAGGATTCTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010180.2-1038s21c1
Sequence:CCGGTCTAGGCAACTGCATTGATATCTCGAGATATCAATGCAGTTGCCTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010180.2-426s21c1
Sequence:CCGGCCTTGAGACCATCTTCATAAACTCGAGTTTATGAAGATGGTCTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010180.2-762s21c1
Sequence:CCGGTGGTGTCTCCTGCGAAGATATCTCGAGATATCTTCGCAGGAGACACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010180.2-927s21c1
Sequence:CCGGATGTGAGACTGGTATTCATAACTCGAGTTATGAATACCAGTCTCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010180
VALIDATED
FBLN1 MISSION shRNA Lentiviral Transduction Particles
fibulin 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000109655    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010180.1-2322s1c1
Sequence:CCGGCCTCCCTTGATGTTTCATATTCTCGAGAATATGAAACATCAAGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010180.1-2049s1c1
Sequence:CCGGCCTTCGAGACTCCTTTGATATCTCGAGATATCAAAGGAGTCTCGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010180.1-2154s1c1
Sequence:CCGGGCTGGAGATGAACTACGTGTTCTCGAGAACACGTAGTTCATCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010180.1-895s1c1
Sequence:CCGGGAGGATAATAACTGCAAAGATCTCGAGATCTTTGCAGTTATTATCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010180.1-236s1c1
Sequence:CCGGCGGATCCAAATCAGATGGCTACTCGAGTAGCCATCTGATTTGGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010180.2-819s21c1
Sequence:CCGGGGGAGAATCCTGCATCAATACCTCGAGGTATTGATGCAGGATTCTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010180.2-1038s21c1
Sequence:CCGGTCTAGGCAACTGCATTGATATCTCGAGATATCAATGCAGTTGCCTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010180.2-426s21c1
Sequence:CCGGCCTTGAGACCATCTTCATAAACTCGAGTTTATGAAGATGGTCTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010180.2-762s21c1
Sequence:CCGGTGGTGTCTCCTGCGAAGATATCTCGAGATATCTTCGCAGGAGACACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010180.2-927s21c1
Sequence:CCGGATGTGAGACTGGTATTCATAACTCGAGTTATGAATACCAGTCTCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001996
VALIDATED
FBLN1 MISSION shRNA Bacterial Glycerol Stock
fibulin 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000055673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_001996.2-785s1c1
Sequence:CCGGCCTGTGAAGATGTCAATGAATCTCGAGATTCATTGACATCTTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_001996.2-618s1c1
Sequence:CCGGCCTCCAAGAAACGGATAAGATCTCGAGATCTTATCCGTTTCTTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001996.2-831s1c1
Sequence:CCGGGCTTGGAGAATCCTGCATCAACTCGAGTTGATGCAGGATTCTCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_001996.2-1293s1c1
Sequence:CCGGCGAATGCAAGACGGGTTACTACTCGAGTAGTAACCCGTCTTGCATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001996.2-1893s1c1
Sequence:CCGGGCCTCTGAGAATAACCTACTACTCGAGTAGTAGGTTATTCTCAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_001996.2-785s21c1
Sequence:CCGGCCTGTGAAGATGTCAATGAATCTCGAGATTCATTGACATCTTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_001996.2-618s21c1
Sequence:CCGGCCTCCAAGAAACGGATAAGATCTCGAGATCTTATCCGTTTCTTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001996.2-831s21c1
Sequence:CCGGGCTTGGAGAATCCTGCATCAACTCGAGTTGATGCAGGATTCTCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001996.2-1293s21c1
Sequence:CCGGCGAATGCAAGACGGGTTACTACTCGAGTAGTAACCCGTCTTGCATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001996
VALIDATED
FBLN1 MISSION shRNA shRNA Plasmid DNA
fibulin 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000055673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_001996.2-785s1c1
Sequence:CCGGCCTGTGAAGATGTCAATGAATCTCGAGATTCATTGACATCTTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_001996.2-618s1c1
Sequence:CCGGCCTCCAAGAAACGGATAAGATCTCGAGATCTTATCCGTTTCTTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001996.2-831s1c1
Sequence:CCGGGCTTGGAGAATCCTGCATCAACTCGAGTTGATGCAGGATTCTCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_001996.2-1293s1c1
Sequence:CCGGCGAATGCAAGACGGGTTACTACTCGAGTAGTAACCCGTCTTGCATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001996.2-1893s1c1
Sequence:CCGGGCCTCTGAGAATAACCTACTACTCGAGTAGTAGGTTATTCTCAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_001996.2-785s21c1
Sequence:CCGGCCTGTGAAGATGTCAATGAATCTCGAGATTCATTGACATCTTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_001996.2-618s21c1
Sequence:CCGGCCTCCAAGAAACGGATAAGATCTCGAGATCTTATCCGTTTCTTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001996.2-831s21c1
Sequence:CCGGGCTTGGAGAATCCTGCATCAACTCGAGTTGATGCAGGATTCTCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001996.2-1293s21c1
Sequence:CCGGCGAATGCAAGACGGGTTACTACTCGAGTAGTAACCCGTCTTGCATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001996
VALIDATED
FBLN1 MISSION shRNA Lentiviral Transduction Particles
fibulin 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000055673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_001996.2-785s1c1
Sequence:CCGGCCTGTGAAGATGTCAATGAATCTCGAGATTCATTGACATCTTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_001996.2-618s1c1
Sequence:CCGGCCTCCAAGAAACGGATAAGATCTCGAGATCTTATCCGTTTCTTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001996.2-831s1c1
Sequence:CCGGGCTTGGAGAATCCTGCATCAACTCGAGTTGATGCAGGATTCTCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_001996.2-1293s1c1
Sequence:CCGGCGAATGCAAGACGGGTTACTACTCGAGTAGTAACCCGTCTTGCATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001996.2-1893s1c1
Sequence:CCGGGCCTCTGAGAATAACCTACTACTCGAGTAGTAGGTTATTCTCAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_001996.2-785s21c1
Sequence:CCGGCCTGTGAAGATGTCAATGAATCTCGAGATTCATTGACATCTTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_001996.2-618s21c1
Sequence:CCGGCCTCCAAGAAACGGATAAGATCTCGAGATCTTATCCGTTTCTTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001996.2-831s21c1
Sequence:CCGGGCTTGGAGAATCCTGCATCAACTCGAGTTGATGCAGGATTCTCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001996.2-1293s21c1
Sequence:CCGGCGAATGCAAGACGGGTTACTACTCGAGTAGTAACCCGTCTTGCATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks