EMAIL THIS PAGE TO A FRIEND

FBLN2

fibulin 2

114 Gene Product Result for
UniProtKB ID: P98095, B7Z9C5, Q8IUI0, Q8IUI1
Gene ID:
Human(2199) Summary: This gene encodes an extracellular matrix protein, which belongs to the fibulin family. This protein binds various extracellular ligands and calcium. It may play a role during organ development, in particular, during the differentiation of heart, skeletal and neuronal structures. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Mouse(14115) fibulin 2
Rat(282583) fibulin 2
Zebrafish(553503) fibulin 2
cow(511854) fibulin 2
dog(484634) fibulin 2
chicken(427583) fibulin 2
sheep(101110183) fibulin 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0904 AQUA Peptide IGPAPAFAGDTISLTIT[K] mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001004019 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001004019 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001004019 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007992 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007992 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007992 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004019 Rosetta Predictions human pricing
NM_001998 Rosetta Predictions human pricing
XM_001062865 Rosetta Predictions rat pricing
XM_001073286 Rosetta Predictions rat pricing
XM_001073317 Rosetta Predictions rat pricing
XM_232197 Rosetta Predictions rat pricing
NM_001081437 Rosetta Predictions mouse pricing
NM_007992 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004019 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00304438 predicted 621
2 SASI_Hs02_00304439 predicted 3932
3 SASI_Hs01_00021311 predicted 3516
4 SASI_Hs02_00304440 predicted 2956
5 SASI_Hs02_00304441 predicted 474
6 SASI_Hs01_00021313 predicted 3615
7 SASI_Hs01_00021314 predicted 1470
8 SASI_Hs01_00021316 predicted 1741
9 SASI_Hs01_00021318 predicted 1289
10 SASI_Hs01_00021319 predicted 3418
11 SASI_Hs01_00021310 predicted 3908
12 SASI_Hs01_00021312 predicted 3273
13 SASI_Hs01_00021315 predicted 443
14 SASI_Hs01_00021317 predicted 2847
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001998 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00332989 predicted 616
2 SASI_Hs02_00332990 predicted 3787
3 SASI_Hs01_00171221 predicted 3378
4 SASI_Hs02_00332991 predicted 2811
5 SASI_Hs02_00332992 predicted 472
6 SASI_Hs01_00171223 predicted 3474
7 SASI_Hs01_00171224 predicted 1467
8 SASI_Hs01_00171226 predicted 1739
9 SASI_Hs01_00171228 predicted 1294
10 SASI_Hs01_00171229 predicted 3279
11 SASI_Hs01_00171220 predicted 3762
12 SASI_Hs01_00171222 predicted 3141
13 SASI_Hs01_00171225 predicted 443
14 SASI_Hs01_00171227 predicted 2700
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001062865 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00304887 predicted 2488
2 SASI_Rn02_00304888 predicted 2109
3 SASI_Rn02_00304889 predicted 3251
4 SASI_Rn02_00304890 predicted 3527
5 SASI_Rn02_00304891 predicted 3294
6 SASI_Rn02_00304892 predicted 465
7 SASI_Rn02_00304893 predicted 1860
8 SASI_Rn02_00304894 predicted 728
9 SASI_Rn02_00304895 predicted 672
10 SASI_Rn02_00304896 predicted 2544
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001073286 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00342225 predicted 2492
2 SASI_Rn02_00342226 predicted 2112
3 SASI_Rn02_00342227 predicted 3250
4 SASI_Rn02_00342228 predicted 3531
5 SASI_Rn02_00342229 predicted 3299
6 SASI_Rn02_00342230 predicted 462
7 SASI_Rn02_00342231 predicted 1868
8 SASI_Rn02_00342232 predicted 721
9 SASI_Rn02_00342233 predicted 675
10 SASI_Rn02_00342234 predicted 2547
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001073317 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00342362 predicted 2677
2 SASI_Rn02_00342363 predicted 2153
3 SASI_Rn02_00342364 predicted 3714
4 SASI_Rn02_00342365 predicted 3477
5 SASI_Rn02_00342366 predicted 508
6 SASI_Rn02_00342367 predicted 1907
7 SASI_Rn02_00342368 predicted 2300
8 SASI_Rn02_00342369 predicted 764
9 SASI_Rn02_00342370 predicted 717
10 SASI_Rn02_00342371 predicted 2726
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_232197 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00387001 predicted 2671
2 SASI_Rn02_00387002 predicted 2151
3 SASI_Rn02_00387003 predicted 3709
4 SASI_Rn02_00387004 predicted 3484
5 SASI_Rn02_00387005 predicted 511
6 SASI_Rn02_00387006 predicted 1902
7 SASI_Rn02_00387007 predicted 2305
8 SASI_Rn02_00387008 predicted 768
9 SASI_Rn02_00387009 predicted 712
10 SASI_Rn02_00387010 predicted 2731
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081437 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00298371 predicted 505
2 SASI_Mm02_00298372 predicted 1061
3 SASI_Mm02_00298373 predicted 765
4 SASI_Mm02_00298374 predicted 3290
5 SASI_Mm02_00298375 predicted 3336
6 SASI_Mm02_00298376 predicted 1904
7 SASI_Mm02_00298377 predicted 2981
8 SASI_Mm02_00298378 predicted 370
9 SASI_Mm02_00298379 predicted 2693
10 SASI_Mm02_00298380 predicted 2550
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007992 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00040592 predicted 509
2 SASI_Mm02_00312909 predicted 1064
3 SASI_Mm01_00040593 predicted 768
4 SASI_Mm01_00040595 predicted 3430
5 SASI_Mm02_00312910 predicted 3480
6 SASI_Mm01_00040598 predicted 1903
7 SASI_Mm01_00040599 predicted 3125
8 SASI_Mm01_00040600 predicted 368
9 SASI_Mm02_00312911 predicted 2828
10 SASI_Mm02_00312912 predicted 2684
11 SASI_Mm01_00040594 predicted 1334
12 SASI_Mm01_00040596 predicted 3333
13 SASI_Mm01_00040597 predicted 413
14 SASI_Mm01_00040601 predicted 2018
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001004019
VALIDATED
FBLN2 MISSION shRNA Bacterial Glycerol Stock
fibulin 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000443002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004019.1-3082s21c1
Sequence:CCGGAGCGCTGTGAAGACGTGAATGCTCGAGCATTCACGTCTTCACAGCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004019.1-318s21c1
Sequence:CCGGTGCGAGGGCTACCAGTACTATCTCGAGATAGTACTGGTAGCCCTCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001004019.1-2099s1c1
Sequence:CCGGGCCTGCACTGAAGTCAGAATTCTCGAGAATTCTGACTTCAGTGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004019.1-1972s1c1
Sequence:CCGGGCCAGCACCTTTGCATCAATACTCGAGTATTGATGCAAAGGTGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004019.1-3620s1c1
Sequence:CCGGCCTGAACATCATCAAGGGCAACTCGAGTTGCCCTTGATGATGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055803    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001004019.1-4148s1c1
Sequence:CCGGCCCAAAGTTGACATTCCATTTCTCGAGAAATGGAATGTCAACTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001004019.1-2382s1c1
Sequence:CCGGGCCGATGGCTATATCCTCAATCTCGAGATTGAGGATATAGCCATCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001004019
VALIDATED
FBLN2 MISSION shRNA shRNA Plasmid DNA
fibulin 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000443002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004019.1-3082s21c1
Sequence:CCGGAGCGCTGTGAAGACGTGAATGCTCGAGCATTCACGTCTTCACAGCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004019.1-318s21c1
Sequence:CCGGTGCGAGGGCTACCAGTACTATCTCGAGATAGTACTGGTAGCCCTCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001004019.1-2099s1c1
Sequence:CCGGGCCTGCACTGAAGTCAGAATTCTCGAGAATTCTGACTTCAGTGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004019.1-1972s1c1
Sequence:CCGGGCCAGCACCTTTGCATCAATACTCGAGTATTGATGCAAAGGTGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004019.1-3620s1c1
Sequence:CCGGCCTGAACATCATCAAGGGCAACTCGAGTTGCCCTTGATGATGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055803    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001004019.1-4148s1c1
Sequence:CCGGCCCAAAGTTGACATTCCATTTCTCGAGAAATGGAATGTCAACTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001004019.1-2382s1c1
Sequence:CCGGGCCGATGGCTATATCCTCAATCTCGAGATTGAGGATATAGCCATCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001004019
VALIDATED
FBLN2 MISSION shRNA Lentiviral Transduction Particles
fibulin 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000443002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004019.1-3082s21c1
Sequence:CCGGAGCGCTGTGAAGACGTGAATGCTCGAGCATTCACGTCTTCACAGCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004019.1-318s21c1
Sequence:CCGGTGCGAGGGCTACCAGTACTATCTCGAGATAGTACTGGTAGCCCTCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001004019.1-2099s1c1
Sequence:CCGGGCCTGCACTGAAGTCAGAATTCTCGAGAATTCTGACTTCAGTGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004019.1-1972s1c1
Sequence:CCGGGCCAGCACCTTTGCATCAATACTCGAGTATTGATGCAAAGGTGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004019.1-3620s1c1
Sequence:CCGGCCTGAACATCATCAAGGGCAACTCGAGTTGCCCTTGATGATGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055803    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001004019.1-4148s1c1
Sequence:CCGGCCCAAAGTTGACATTCCATTTCTCGAGAAATGGAATGTCAACTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001004019.1-2382s1c1
Sequence:CCGGGCCGATGGCTATATCCTCAATCTCGAGATTGAGGATATAGCCATCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007992
VALIDATED
FBLN2 MISSION shRNA Bacterial Glycerol Stock
fibulin 2
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000334143    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007992.2-4135s21c1
Sequence:CCGGGCATGGTAGCACAGACCTTTACTCGAGTAAAGGTCTGTGCTACCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007992.2-638s21c1
Sequence:CCGGACGCTGGTGGTGAGCTCATTTCTCGAGAAATGAGCTCACCACCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007992.2-3285s21c1
Sequence:CCGGATGCCCAGAGCAAGGGTATACCTCGAGGTATACCCTTGCTCTGGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007992.2-3520s21c1
Sequence:CCGGACGCACTACCAGCTCAATTTCCTCGAGGAAATTGAGCTGGTAGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007992.2-3422s21c1
Sequence:CCGGTTGATTGTCCACCCAACTATGCTCGAGCATAGTTGGGTGGACAATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007992.2-566s21c1
Sequence:CCGGTCCACAGTGGCCGTAAGTATGCTCGAGCATACTTACGGCCACTGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007992.2-2370s21c1
Sequence:CCGGGCTGTGTGCAGAGGGCTATATCTCGAGATATAGCCCTCTGCACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007992.1-1421s1c1
Sequence:CCGGCCAGAGTGACATCTGTAGGATCTCGAGATCCTACAGATGTCACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007992.1-3030s1c1
Sequence:CCGGGCCAACATCTATGGCTCCTATCTCGAGATAGGAGCCATAGATGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007992.1-2204s1c1
Sequence:CCGGCGATTGTAGCTGGAAACAGTTCTCGAGAACTGTTTCCAGCTACAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007992.1-402s1c1
Sequence:CCGGCCCAACTGCATTGAAGCTGTACTCGAGTACAGCTTCAATGCAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109475    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007992.1-4035s1c1
Sequence:CCGGGCATGGTAGCACAGACCTTTACTCGAGTAAAGGTCTGTGCTACCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007992
VALIDATED
FBLN2 MISSION shRNA shRNA Plasmid DNA
fibulin 2
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000334143    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007992.2-4135s21c1
Sequence:CCGGGCATGGTAGCACAGACCTTTACTCGAGTAAAGGTCTGTGCTACCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007992.2-638s21c1
Sequence:CCGGACGCTGGTGGTGAGCTCATTTCTCGAGAAATGAGCTCACCACCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007992.2-3285s21c1
Sequence:CCGGATGCCCAGAGCAAGGGTATACCTCGAGGTATACCCTTGCTCTGGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007992.2-3520s21c1
Sequence:CCGGACGCACTACCAGCTCAATTTCCTCGAGGAAATTGAGCTGGTAGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007992.2-3422s21c1
Sequence:CCGGTTGATTGTCCACCCAACTATGCTCGAGCATAGTTGGGTGGACAATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007992.2-566s21c1
Sequence:CCGGTCCACAGTGGCCGTAAGTATGCTCGAGCATACTTACGGCCACTGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007992.2-2370s21c1
Sequence:CCGGGCTGTGTGCAGAGGGCTATATCTCGAGATATAGCCCTCTGCACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007992.1-1421s1c1
Sequence:CCGGCCAGAGTGACATCTGTAGGATCTCGAGATCCTACAGATGTCACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007992.1-3030s1c1
Sequence:CCGGGCCAACATCTATGGCTCCTATCTCGAGATAGGAGCCATAGATGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007992.1-2204s1c1
Sequence:CCGGCGATTGTAGCTGGAAACAGTTCTCGAGAACTGTTTCCAGCTACAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007992.1-402s1c1
Sequence:CCGGCCCAACTGCATTGAAGCTGTACTCGAGTACAGCTTCAATGCAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109475    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007992.1-4035s1c1
Sequence:CCGGGCATGGTAGCACAGACCTTTACTCGAGTAAAGGTCTGTGCTACCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007992
VALIDATED
FBLN2 MISSION shRNA Lentiviral Transduction Particles
fibulin 2
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000334143    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007992.2-4135s21c1
Sequence:CCGGGCATGGTAGCACAGACCTTTACTCGAGTAAAGGTCTGTGCTACCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007992.2-638s21c1
Sequence:CCGGACGCTGGTGGTGAGCTCATTTCTCGAGAAATGAGCTCACCACCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007992.2-3285s21c1
Sequence:CCGGATGCCCAGAGCAAGGGTATACCTCGAGGTATACCCTTGCTCTGGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007992.2-3520s21c1
Sequence:CCGGACGCACTACCAGCTCAATTTCCTCGAGGAAATTGAGCTGGTAGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007992.2-3422s21c1
Sequence:CCGGTTGATTGTCCACCCAACTATGCTCGAGCATAGTTGGGTGGACAATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007992.2-566s21c1
Sequence:CCGGTCCACAGTGGCCGTAAGTATGCTCGAGCATACTTACGGCCACTGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007992.2-2370s21c1
Sequence:CCGGGCTGTGTGCAGAGGGCTATATCTCGAGATATAGCCCTCTGCACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007992.1-1421s1c1
Sequence:CCGGCCAGAGTGACATCTGTAGGATCTCGAGATCCTACAGATGTCACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007992.1-3030s1c1
Sequence:CCGGGCCAACATCTATGGCTCCTATCTCGAGATAGGAGCCATAGATGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007992.1-2204s1c1
Sequence:CCGGCGATTGTAGCTGGAAACAGTTCTCGAGAACTGTTTCCAGCTACAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007992.1-402s1c1
Sequence:CCGGCCCAACTGCATTGAAGCTGTACTCGAGTACAGCTTCAATGCAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109475    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007992.1-4035s1c1
Sequence:CCGGGCATGGTAGCACAGACCTTTACTCGAGTAAAGGTCTGTGCTACCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks