EMAIL THIS PAGE TO A FRIEND

FBLN5

fibulin 5

101 Gene Product Result for
Synonyms: ADCL2 ARCL1A ARMD3 DANCE EVEC FIBL-5 UP50
UniProtKB ID: Q9UBX5, O75966, Q6IAL4, Q6UWA3
Gene ID:
Human(10516) Summary: The protein encoded by this gene is a secreted, extracellular matrix protein containing an Arg-Gly-Asp (RGD) motif and calcium-binding EGF-like domains. It promotes adhesion of endothelial cells through interaction of integrins and the RGD motif. It is prominently expressed in developing arteries but less so in adult vessels. However, its expression is reinduced in balloon-injured vessels and atherosclerotic lesions, notably in intimal vascular smooth muscle cells and endothelial cells. Therefore, the protein encoded by this gene may play a role in vascular development and remodeling. Defects in this gene are a cause of autosomal dominant cutis laxa, autosomal recessive cutis laxa type I (CL type I), and age-related macular degeneration type 3 (ARMD3). [provided by RefSeq, Jul 2008]
Mouse(23876) fibulin 5
Rat(29158) fibulin 5
sheep(101112927) fibulin 5
Zebrafish(449806) fibulin 5
cow(535185) fibulin 5
Horse(100063331) fibulin 5
dog(480227) fibulin 5
chicken(423413) fibulin 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011812 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011812 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011812 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006329 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006329 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006329 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006329 Rosetta Predictions human pricing
NM_019153 Rosetta Predictions rat pricing
NM_011812 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006329 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00127708 predicted 635
2 SASI_Hs01_00127709 predicted 1438
3 SASI_Hs01_00127710 predicted 1917
4 SASI_Hs01_00127711 predicted 1560
5 SASI_Hs01_00127712 predicted 1014
6 SASI_Hs02_00341359 predicted 686
7 SASI_Hs01_00127714 predicted 1014
8 SASI_Hs01_00127715 predicted 552
9 SASI_Hs02_00341360 predicted 498
10 SASI_Hs01_00127716 predicted 682
11 SASI_Hs01_00127713 predicted 1615
12 SASI_Hs01_00127717 predicted 1117
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019153 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00081467 predicted 313
2 SASI_Rn02_00261925 predicted 1549
3 SASI_Rn02_00261926 predicted 339
4 SASI_Rn01_00081469 predicted 1393
5 SASI_Rn01_00081470 predicted 886
6 SASI_Rn02_00261927 predicted 1498
7 SASI_Rn01_00081472 predicted 532
8 SASI_Rn01_00081473 predicted 1303
9 SASI_Rn02_00261928 predicted 898
10 SASI_Rn02_00261929 predicted 406
11 SASI_Rn01_00081465 predicted 1540
12 SASI_Rn01_00081466 predicted 568
13 SASI_Rn01_00081468 predicted 1000
14 SASI_Rn01_00081471 predicted 1523
15 SASI_Rn01_00081474 predicted 846
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011812 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00111844 predicted 389
2 SASI_Mm01_00111845 predicted 1174
3 SASI_Mm01_00111846 predicted 333
4 SASI_Mm01_00111847 predicted 523
5 SASI_Mm01_00111848 predicted 1624
6 SASI_Mm01_00111849 predicted 1392
7 SASI_Mm01_00111850 predicted 1264
8 SASI_Mm01_00111851 predicted 320
9 SASI_Mm01_00111852 predicted 1745
10 SASI_Mm01_00111853 predicted 1471
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011812
VALIDATED
FBLN5 MISSION shRNA Bacterial Glycerol Stock
fibulin 5
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000109610    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011812.2-2378s1c1
Sequence:CCGGCCCTTAATCATGCTTTCTTAACTCGAGTTAAGAAAGCATGATTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011812.2-1275s1c1
Sequence:CCGGCCTTATCTGCTGATTGGTGAACTCGAGTTCACCAATCAGCAGATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011812.2-515s1c1
Sequence:CCGGCCCTCGAACCAACCCAGTGTACTCGAGTACACTGGGTTGGTTCGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011812.2-1476s1c1
Sequence:CCGGCGAGAGTTCTATATGCGGCAACTCGAGTTGCCGCATATAGAACTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011812.2-810s1c1
Sequence:CCGGGATATTGATGAATGTCGCTATCTCGAGATAGCGACATTCATCAATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011812.3-534s21c1
Sequence:CCGGTATCGAGGGCCTTACTCAAATCTCGAGATTTGAGTAAGGCCCTCGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011812.3-1476s21c1
Sequence:CCGGCGAGAGTTCTATATGCGGCAACTCGAGTTGCCGCATATAGAACTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011812.3-1275s21c1
Sequence:CCGGCCTTATCTGCTGATTGGTGAACTCGAGTTCACCAATCAGCAGATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317792    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011812.3-2378s21c1
Sequence:CCGGCCCTTAATCATGCTTTCTTAACTCGAGTTAAGAAAGCATGATTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011812.3-1424s21c1
Sequence:CCGGCCGATACCCTGGTGCCTATTACTCGAGTAATAGGCACCAGGGTATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011812
VALIDATED
FBLN5 MISSION shRNA shRNA Plasmid DNA
fibulin 5
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000109610    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011812.2-2378s1c1
Sequence:CCGGCCCTTAATCATGCTTTCTTAACTCGAGTTAAGAAAGCATGATTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011812.2-1275s1c1
Sequence:CCGGCCTTATCTGCTGATTGGTGAACTCGAGTTCACCAATCAGCAGATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011812.2-515s1c1
Sequence:CCGGCCCTCGAACCAACCCAGTGTACTCGAGTACACTGGGTTGGTTCGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011812.2-1476s1c1
Sequence:CCGGCGAGAGTTCTATATGCGGCAACTCGAGTTGCCGCATATAGAACTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011812.2-810s1c1
Sequence:CCGGGATATTGATGAATGTCGCTATCTCGAGATAGCGACATTCATCAATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011812.3-534s21c1
Sequence:CCGGTATCGAGGGCCTTACTCAAATCTCGAGATTTGAGTAAGGCCCTCGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011812.3-1476s21c1
Sequence:CCGGCGAGAGTTCTATATGCGGCAACTCGAGTTGCCGCATATAGAACTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011812.3-1275s21c1
Sequence:CCGGCCTTATCTGCTGATTGGTGAACTCGAGTTCACCAATCAGCAGATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317792    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011812.3-2378s21c1
Sequence:CCGGCCCTTAATCATGCTTTCTTAACTCGAGTTAAGAAAGCATGATTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011812.3-1424s21c1
Sequence:CCGGCCGATACCCTGGTGCCTATTACTCGAGTAATAGGCACCAGGGTATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011812
VALIDATED
FBLN5 MISSION shRNA Lentiviral Transduction Particles
fibulin 5
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000109610    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011812.2-2378s1c1
Sequence:CCGGCCCTTAATCATGCTTTCTTAACTCGAGTTAAGAAAGCATGATTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011812.2-1275s1c1
Sequence:CCGGCCTTATCTGCTGATTGGTGAACTCGAGTTCACCAATCAGCAGATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011812.2-515s1c1
Sequence:CCGGCCCTCGAACCAACCCAGTGTACTCGAGTACACTGGGTTGGTTCGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011812.2-1476s1c1
Sequence:CCGGCGAGAGTTCTATATGCGGCAACTCGAGTTGCCGCATATAGAACTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011812.2-810s1c1
Sequence:CCGGGATATTGATGAATGTCGCTATCTCGAGATAGCGACATTCATCAATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011812.3-534s21c1
Sequence:CCGGTATCGAGGGCCTTACTCAAATCTCGAGATTTGAGTAAGGCCCTCGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011812.3-1476s21c1
Sequence:CCGGCGAGAGTTCTATATGCGGCAACTCGAGTTGCCGCATATAGAACTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011812.3-1275s21c1
Sequence:CCGGCCTTATCTGCTGATTGGTGAACTCGAGTTCACCAATCAGCAGATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317792    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011812.3-2378s21c1
Sequence:CCGGCCCTTAATCATGCTTTCTTAACTCGAGTTAAGAAAGCATGATTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011812.3-1424s21c1
Sequence:CCGGCCGATACCCTGGTGCCTATTACTCGAGTAATAGGCACCAGGGTATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006329
VALIDATED
FBLN5 MISSION shRNA Bacterial Glycerol Stock
fibulin 5
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000053558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_006329.2-1549s1c1
Sequence:CCGGGCTGACATCTTCCAAATGCAACTCGAGTTGCATTTGGAAGATGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_006329.2-622s1c1
Sequence:CCGGCGAGGAGACATGATGTGTGTTCTCGAGAACACACATCATGTCTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_006329.2-1365s1c1
Sequence:CCGGGCAGCAGACGTGCTACAATTTCTCGAGAAATTGTAGCACGTCTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_006329.2-1779s1c1
Sequence:CCGGGCGGATATATGTGTCGCAGTACTCGAGTACTGCGACACATATATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006329.2-1162s1c1
Sequence:CCGGCCAGGATATGAACTTGAGGAACTCGAGTTCCTCAAGTTCATATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_006329.3-790s21c1
Sequence:CCGGCGATCTCCAGGCCTCTTATATCTCGAGATATAAGAGGCCTGGAGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_006329.3-1376s21c1
Sequence:CCGGGCAGCAGACGTGCTACAATTTCTCGAGAAATTGTAGCACGTCTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_006329.3-633s21c1
Sequence:CCGGCGAGGAGACATGATGTGTGTTCTCGAGAACACACATCATGTCTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_006329.3-1560s21c1
Sequence:CCGGGCTGACATCTTCCAAATGCAACTCGAGTTGCATTTGGAAGATGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296506    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_006329.3-1963s21c1
Sequence:CCGGTGACTCTCACCTGTACTATTGCTCGAGCAATAGTACAGGTGAGAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006329
VALIDATED
FBLN5 MISSION shRNA shRNA Plasmid DNA
fibulin 5
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000053558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_006329.2-1549s1c1
Sequence:CCGGGCTGACATCTTCCAAATGCAACTCGAGTTGCATTTGGAAGATGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_006329.2-622s1c1
Sequence:CCGGCGAGGAGACATGATGTGTGTTCTCGAGAACACACATCATGTCTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_006329.2-1365s1c1
Sequence:CCGGGCAGCAGACGTGCTACAATTTCTCGAGAAATTGTAGCACGTCTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_006329.2-1779s1c1
Sequence:CCGGGCGGATATATGTGTCGCAGTACTCGAGTACTGCGACACATATATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006329.2-1162s1c1
Sequence:CCGGCCAGGATATGAACTTGAGGAACTCGAGTTCCTCAAGTTCATATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_006329.3-790s21c1
Sequence:CCGGCGATCTCCAGGCCTCTTATATCTCGAGATATAAGAGGCCTGGAGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_006329.3-1376s21c1
Sequence:CCGGGCAGCAGACGTGCTACAATTTCTCGAGAAATTGTAGCACGTCTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_006329.3-633s21c1
Sequence:CCGGCGAGGAGACATGATGTGTGTTCTCGAGAACACACATCATGTCTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_006329.3-1560s21c1
Sequence:CCGGGCTGACATCTTCCAAATGCAACTCGAGTTGCATTTGGAAGATGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296506    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_006329.3-1963s21c1
Sequence:CCGGTGACTCTCACCTGTACTATTGCTCGAGCAATAGTACAGGTGAGAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006329
VALIDATED
FBLN5 MISSION shRNA Lentiviral Transduction Particles
fibulin 5
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000053558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_006329.2-1549s1c1
Sequence:CCGGGCTGACATCTTCCAAATGCAACTCGAGTTGCATTTGGAAGATGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_006329.2-622s1c1
Sequence:CCGGCGAGGAGACATGATGTGTGTTCTCGAGAACACACATCATGTCTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_006329.2-1365s1c1
Sequence:CCGGGCAGCAGACGTGCTACAATTTCTCGAGAAATTGTAGCACGTCTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_006329.2-1779s1c1
Sequence:CCGGGCGGATATATGTGTCGCAGTACTCGAGTACTGCGACACATATATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006329.2-1162s1c1
Sequence:CCGGCCAGGATATGAACTTGAGGAACTCGAGTTCCTCAAGTTCATATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_006329.3-790s21c1
Sequence:CCGGCGATCTCCAGGCCTCTTATATCTCGAGATATAAGAGGCCTGGAGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_006329.3-1376s21c1
Sequence:CCGGGCAGCAGACGTGCTACAATTTCTCGAGAAATTGTAGCACGTCTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_006329.3-633s21c1
Sequence:CCGGCGAGGAGACATGATGTGTGTTCTCGAGAACACACATCATGTCTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_006329.3-1560s21c1
Sequence:CCGGGCTGACATCTTCCAAATGCAACTCGAGTTGCATTTGGAAGATGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296506    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_006329.3-1963s21c1
Sequence:CCGGTGACTCTCACCTGTACTATTGCTCGAGCAATAGTACAGGTGAGAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks