EMAIL THIS PAGE TO A FRIEND

FBLN7

fibulin 7

76 Gene Product Result for
Synonyms: TM14
UniProtKB ID: Q53RD9, A0JNV1, A0JNV2, Q5H9P5, Q8N9G0
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024237 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024237 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024237 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_153214 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153214 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153214 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001128165 Rosetta Predictions human pricing
NM_153214 Rosetta Predictions human pricing
XM_001081124 Rosetta Predictions rat pricing
XM_215832 Rosetta Predictions rat pricing
NM_024237 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001128165 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00330656 predicted 1306
2 SASI_Hs02_00330657 predicted 1177
3 SASI_Hs02_00330658 predicted 537
4 SASI_Hs02_00330659 predicted 1174
5 SASI_Hs02_00330660 predicted 1134
6 SASI_Hs02_00330661 predicted 557
7 SASI_Hs02_00330662 predicted 1072
8 SASI_Hs02_00330663 predicted 1937
9 SASI_Hs02_00330664 predicted 1134
10 SASI_Hs02_00330665 predicted 868
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153214 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00063916 predicted 1447
2 SASI_Hs01_00063917 predicted 1316
3 SASI_Hs01_00063918 predicted 545
4 SASI_Hs01_00063919 predicted 1314
5 SASI_Hs01_00063920 predicted 1276
6 SASI_Hs01_00063921 predicted 619
7 SASI_Hs01_00063922 predicted 557
8 SASI_Hs01_00063924 predicted 1208
9 SASI_Hs01_00063925 predicted 2077
10 SASI_Hs02_00367074 predicted 1276
11 SASI_Hs01_00063923 predicted 1555
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081124 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00370645 predicted 1898
2 SASI_Rn02_00370646 predicted 1886
3 SASI_Rn02_00370647 predicted 635
4 SASI_Rn02_00370648 predicted 1951
5 SASI_Rn02_00370649 predicted 1670
6 SASI_Rn02_00370650 predicted 1801
7 SASI_Rn02_00370651 predicted 1293
8 SASI_Rn02_00370652 predicted 1832
9 SASI_Rn02_00370653 predicted 1056
10 SASI_Rn02_00370654 predicted 1731
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_215832 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00376225 predicted 1215
2 SASI_Rn02_00376226 predicted 567
3 SASI_Rn02_00376227 predicted 1265
4 SASI_Rn02_00376228 predicted 1012
5 SASI_Rn02_00376229 predicted 710
6 SASI_Rn02_00376230 predicted 283
7 SASI_Rn02_00376231 predicted 1131
8 SASI_Rn02_00376232 predicted 1220
9 SASI_Rn02_00376233 predicted 1258
10 SASI_Rn02_00376234 predicted 879
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024237 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00037373 predicted 1348
2 SASI_Mm01_00037374 predicted 492
3 SASI_Mm01_00037376 predicted 1187
4 SASI_Mm02_00327607 predicted 1325
5 SASI_Mm02_00327608 predicted 1317
6 SASI_Mm01_00037377 predicted 1056
7 SASI_Mm01_00037379 predicted 1427
8 SASI_Mm01_00037380 predicted 1084
9 SASI_Mm01_00037381 predicted 1356
10 SASI_Mm01_00037382 predicted 811
11 SASI_Mm01_00037375 predicted 1278
12 SASI_Mm01_00037378 predicted 1105
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024237
FBLN7 MISSION shRNA Bacterial Glycerol Stock
fibulin 7
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000442728    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024237.4-1941s21c1
Sequence:CCGGGCTACCTACCAGGGTACTTTACTCGAGTAAAGTACCCTGGTAGGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024237.4-416s21c1
Sequence:CCGGAGTTTGGAAGCAAGTACTTAGCTCGAGCTAAGTACTTGCTTCCAAACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024237.4-493s21c1
Sequence:CCGGAGCGTGGTGTGTCTTGCTAATCTCGAGATTAGCAAGACACACCACGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024237.2-1371s1c1
Sequence:CCGGCCATGTATCCAAGGTCACCATCTCGAGATGGTGACCTTGGATACATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024237.2-1098s1c1
Sequence:CCGGCAAGACCATCTCCTTCCATTACTCGAGTAATGGAAGGAGATGGTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024237.2-1011s1c1
Sequence:CCGGCGGCAATATAAGCTACGTGAACTCGAGTTCACGTAGCTTATATTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109550    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024237.2-1444s1c1
Sequence:CCGGGTTTGAGATCTGGGCTGATTTCTCGAGAAATCAGCCCAGATCTCAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024237
FBLN7 MISSION shRNA shRNA Plasmid DNA
fibulin 7
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000442728    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024237.4-1941s21c1
Sequence:CCGGGCTACCTACCAGGGTACTTTACTCGAGTAAAGTACCCTGGTAGGTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024237.4-416s21c1
Sequence:CCGGAGTTTGGAAGCAAGTACTTAGCTCGAGCTAAGTACTTGCTTCCAAACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024237.4-493s21c1
Sequence:CCGGAGCGTGGTGTGTCTTGCTAATCTCGAGATTAGCAAGACACACCACGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024237.2-1371s1c1
Sequence:CCGGCCATGTATCCAAGGTCACCATCTCGAGATGGTGACCTTGGATACATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024237.2-1098s1c1
Sequence:CCGGCAAGACCATCTCCTTCCATTACTCGAGTAATGGAAGGAGATGGTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024237.2-1011s1c1
Sequence:CCGGCGGCAATATAAGCTACGTGAACTCGAGTTCACGTAGCTTATATTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109550    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024237.2-1444s1c1
Sequence:CCGGGTTTGAGATCTGGGCTGATTTCTCGAGAAATCAGCCCAGATCTCAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024237
FBLN7 MISSION shRNA Lentiviral Transduction Particles
fibulin 7
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000442728    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024237.4-1941s21c1
Sequence:CCGGGCTACCTACCAGGGTACTTTACTCGAGTAAAGTACCCTGGTAGGTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024237.4-416s21c1
Sequence:CCGGAGTTTGGAAGCAAGTACTTAGCTCGAGCTAAGTACTTGCTTCCAAACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024237.4-493s21c1
Sequence:CCGGAGCGTGGTGTGTCTTGCTAATCTCGAGATTAGCAAGACACACCACGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024237.2-1371s1c1
Sequence:CCGGCCATGTATCCAAGGTCACCATCTCGAGATGGTGACCTTGGATACATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024237.2-1098s1c1
Sequence:CCGGCAAGACCATCTCCTTCCATTACTCGAGTAATGGAAGGAGATGGTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024237.2-1011s1c1
Sequence:CCGGCGGCAATATAAGCTACGTGAACTCGAGTTCACGTAGCTTATATTGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109550    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024237.2-1444s1c1
Sequence:CCGGGTTTGAGATCTGGGCTGATTTCTCGAGAAATCAGCCCAGATCTCAAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153214
VALIDATED
FBLN7 MISSION shRNA Bacterial Glycerol Stock
fibulin 7
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000421808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153214.2-1501s21c1
Sequence:CCGGGGACGTCGACATGTCGGAATACTCGAGTATTCCGACATGTCGACGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153214.1-538s1c1
Sequence:CCGGCGGCAGAAAGTTTGGAAGCAACTCGAGTTGCTTCCAAACTTTCTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153214.1-1272s1c1
Sequence:CCGGCCAAGACCATCTCCTTCCATTCTCGAGAATGGAAGGAGATGGTCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153214.1-341s1c1
Sequence:CCGGTCCCAGAACTGTCTCAGCAAACTCGAGTTTGCTGAGACAGTTCTGGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153214.1-747s1c1
Sequence:CCGGGATGCATTTGTCCTCCAGGAACTCGAGTTCCTGGAGGACAAATGCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153214.1-1186s1c1
Sequence:CCGGCGGCAATGTGAGCTACGTGAACTCGAGTTCACGTAGCTCACATTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153214.1-1186s1c2
Sequence:CCGGCGGCAATGTGAGCTACGTGAACTCGAGTTCACGTAGCTCACATTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153214
VALIDATED
FBLN7 MISSION shRNA shRNA Plasmid DNA
fibulin 7
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000421808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153214.2-1501s21c1
Sequence:CCGGGGACGTCGACATGTCGGAATACTCGAGTATTCCGACATGTCGACGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153214.1-538s1c1
Sequence:CCGGCGGCAGAAAGTTTGGAAGCAACTCGAGTTGCTTCCAAACTTTCTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153214.1-1272s1c1
Sequence:CCGGCCAAGACCATCTCCTTCCATTCTCGAGAATGGAAGGAGATGGTCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153214.1-341s1c1
Sequence:CCGGTCCCAGAACTGTCTCAGCAAACTCGAGTTTGCTGAGACAGTTCTGGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153214.1-747s1c1
Sequence:CCGGGATGCATTTGTCCTCCAGGAACTCGAGTTCCTGGAGGACAAATGCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153214.1-1186s1c1
Sequence:CCGGCGGCAATGTGAGCTACGTGAACTCGAGTTCACGTAGCTCACATTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153214.1-1186s1c2
Sequence:CCGGCGGCAATGTGAGCTACGTGAACTCGAGTTCACGTAGCTCACATTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153214
VALIDATED
FBLN7 MISSION shRNA Lentiviral Transduction Particles
fibulin 7
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000421808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153214.2-1501s21c1
Sequence:CCGGGGACGTCGACATGTCGGAATACTCGAGTATTCCGACATGTCGACGTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153214.1-538s1c1
Sequence:CCGGCGGCAGAAAGTTTGGAAGCAACTCGAGTTGCTTCCAAACTTTCTGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153214.1-1272s1c1
Sequence:CCGGCCAAGACCATCTCCTTCCATTCTCGAGAATGGAAGGAGATGGTCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153214.1-341s1c1
Sequence:CCGGTCCCAGAACTGTCTCAGCAAACTCGAGTTTGCTGAGACAGTTCTGGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153214.1-747s1c1
Sequence:CCGGGATGCATTTGTCCTCCAGGAACTCGAGTTCCTGGAGGACAAATGCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153214.1-1186s1c1
Sequence:CCGGCGGCAATGTGAGCTACGTGAACTCGAGTTCACGTAGCTCACATTGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153214.1-1186s1c2
Sequence:CCGGCGGCAATGTGAGCTACGTGAACTCGAGTTCACGTAGCTCACATTGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)