EMAIL THIS PAGE TO A FRIEND

FBN1

fibrillin 1

174 Gene Product Result for
Synonyms: ACMICD ECTOL1 FBN GPHYSD2 MASS MFS1 OCTD SGS SSKS WMS WMS2
UniProtKB ID: P35555, B2RUU0, D2JYH6, Q15972, Q75N87
Gene ID:
Human(2200) Summary: This gene encodes a member of the fibrillin family. The encoded protein is a large, extracellular matrix glycoprotein that serve as a structural component of 10-12 nm calcium-binding microfibrils. These microfibrils provide force bearing structural support in elastic and nonelastic connective tissue throughout the body. Mutations in this gene are associated with Marfan syndrome, isolated ectopia lentis, autosomal dominant Weill-Marchesani syndrome, MASS syndrome, and Shprintzen-Goldberg craniosynostosis syndrome. [provided by RefSeq, Jul 2008]
Mouse(14118) fibrillin 1
Rat(83727) fibrillin 1
chicken(373992) fibrillin 1
cow(281154) fibrillin 1
Horse(100055741) fibrillin 1
dog(478293) fibrillin 1
sheep(101109620) fibrillin 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2107947 Anti-FBN1 antibody produced in rabbit affinity isolated antibody human, canine, rat, pig, bovine, mouse
western blot pricing
HPA017759 Anti-FBN1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
AV37969 Anti-FBN1 antibody produced in rabbit affinity isolated antibody, lyophilized powder canine, pig, human, bovine, rat, mouse
western blot pricing
HPA021057 Anti-FBN1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB4500863 Anti-Fibrillin-1, C-Terminal antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunohistochemistry pricing
WH0002200M1 Monoclonal Anti-FBN1 antibody produced in mouse clone 3H6, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
AMAB90585 Monoclonal Anti-FBN1 antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL0226, purified immunoglobulin, buffered aqueous glycerol solution human
immunohistochemistry pricing
AMAB90584 Monoclonal Anti-FBN1 antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL0225, purified immunoglobulin, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007993 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007993 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007993 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000138 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000138 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000138 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU015751 MISSION® esiRNA esiRNA targeting human FBN1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000138 Rosetta Predictions human pricing
NM_031825 Rosetta Predictions rat pricing
NM_007993 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000138 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00033762 predicted 6649
2 SASI_Hs01_00033763 predicted 6923
3 SASI_Hs02_00301947 predicted 7624
4 SASI_Hs01_00033764 predicted 2771
5 SASI_Hs01_00033765 predicted 5330
6 SASI_Hs01_00033766 predicted 479
7 SASI_Hs01_00033767 predicted 2993
8 SASI_Hs01_00033768 predicted 8666
9 SASI_Hs01_00033769 predicted 6908
10 SASI_Hs01_00033771 predicted 2746
11 SASI_Hs01_00033770 predicted 3540
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031825 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00058915 predicted 2743
2 SASI_Rn01_00058916 predicted 2677
3 SASI_Rn01_00058917 predicted 2655
4 SASI_Rn02_00265299 predicted 5559
5 SASI_Rn01_00058918 predicted 6594
6 SASI_Rn01_00058920 predicted 6238
7 SASI_Rn01_00058921 predicted 4791
8 SASI_Rn01_00058922 predicted 6586
9 SASI_Rn01_00058923 predicted 5413
10 SASI_Rn02_00265300 predicted 8655
11 SASI_Rn01_00058914 predicted 1361
12 SASI_Rn01_00058919 predicted 4996
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007993 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00078851 predicted 7593
2 SASI_Mm02_00312913 predicted 5315
3 SASI_Mm01_00078852 predicted 4346
4 SASI_Mm02_00312914 predicted 6590
5 SASI_Mm01_00078853 predicted 5849
6 SASI_Mm01_00078854 predicted 2971
7 SASI_Mm02_00312915 predicted 5075
8 SASI_Mm01_00078857 predicted 2546
9 SASI_Mm01_00078858 predicted 2464
10 SASI_Mm01_00078859 predicted 8321
11 SASI_Mm01_00078855 predicted 1673
12 SASI_Mm01_00078856 predicted 5011
13 SASI_Mm01_00078860 predicted 5495
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007993
VALIDATED
FBN1 MISSION shRNA Bacterial Glycerol Stock
fibrillin 1
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000109515    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007993.1-9294s1c1
Sequence:CCGGCGACACGAGTTAGGAACCAAACTCGAGTTTGGTTCCTAACTCGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007993.1-5783s1c1
Sequence:CCGGGCCAAGAAATCCCGAACATATCTCGAGATATGTTCGGGATTTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007993.1-2480s1c1
Sequence:CCGGCGGGATATGAAGTAGACATAACTCGAGTTATGTCTACTTCATATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007993.1-442s1c1
Sequence:CCGGCCTGGTGGAAATCAGTGTATTCTCGAGAATACACTGATTTCCACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007993.1-5486s1c1
Sequence:CCGGGCTTCGTGATTGACATTTATACTCGAGTATAAATGTCAATCACGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007993.2-7584s21c1
Sequence:CCGGCTGGCTACACTCCGGATATAACTCGAGTTATATCCGGAGTGTAGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007993.2-3866s21c1
Sequence:CCGGAGGCTCTTCTGTGTCGATATTCTCGAGAATATCGACACAGAAGAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007993.2-457s21c1
Sequence:CCGGTGTCTGTGGATCACGTTATAACTCGAGTTATAACGTGATCCACAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339464    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007993.2-9119s21c1
Sequence:CCGGGCTACCCTGTCATGCGTATTGCTCGAGCAATACGCATGACAGGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007993.2-4352s21c1
Sequence:CCGGTGGATTGGAGACGGCATTAAGCTCGAGCTTAATGCCGTCTCCAATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007993.2-5030s21c1
Sequence:CCGGGTGAACACATCTGAGTATAAACTCGAGTTTATACTCAGATGTGTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377027    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007993.2-8947s21c1
Sequence:CCGGACCTTAGGCAGGTAGAATTATCTCGAGATAATTCTACCTGCCTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007993
VALIDATED
FBN1 MISSION shRNA shRNA Plasmid DNA
fibrillin 1
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000109515    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007993.1-9294s1c1
Sequence:CCGGCGACACGAGTTAGGAACCAAACTCGAGTTTGGTTCCTAACTCGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007993.1-5783s1c1
Sequence:CCGGGCCAAGAAATCCCGAACATATCTCGAGATATGTTCGGGATTTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007993.1-2480s1c1
Sequence:CCGGCGGGATATGAAGTAGACATAACTCGAGTTATGTCTACTTCATATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007993.1-442s1c1
Sequence:CCGGCCTGGTGGAAATCAGTGTATTCTCGAGAATACACTGATTTCCACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007993.1-5486s1c1
Sequence:CCGGGCTTCGTGATTGACATTTATACTCGAGTATAAATGTCAATCACGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007993.2-7584s21c1
Sequence:CCGGCTGGCTACACTCCGGATATAACTCGAGTTATATCCGGAGTGTAGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007993.2-3866s21c1
Sequence:CCGGAGGCTCTTCTGTGTCGATATTCTCGAGAATATCGACACAGAAGAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007993.2-457s21c1
Sequence:CCGGTGTCTGTGGATCACGTTATAACTCGAGTTATAACGTGATCCACAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339464    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007993.2-9119s21c1
Sequence:CCGGGCTACCCTGTCATGCGTATTGCTCGAGCAATACGCATGACAGGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007993.2-4352s21c1
Sequence:CCGGTGGATTGGAGACGGCATTAAGCTCGAGCTTAATGCCGTCTCCAATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007993.2-5030s21c1
Sequence:CCGGGTGAACACATCTGAGTATAAACTCGAGTTTATACTCAGATGTGTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377027    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007993.2-8947s21c1
Sequence:CCGGACCTTAGGCAGGTAGAATTATCTCGAGATAATTCTACCTGCCTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007993
VALIDATED
FBN1 MISSION shRNA Lentiviral Transduction Particles
fibrillin 1
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000109515    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007993.1-9294s1c1
Sequence:CCGGCGACACGAGTTAGGAACCAAACTCGAGTTTGGTTCCTAACTCGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007993.1-5783s1c1
Sequence:CCGGGCCAAGAAATCCCGAACATATCTCGAGATATGTTCGGGATTTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007993.1-2480s1c1
Sequence:CCGGCGGGATATGAAGTAGACATAACTCGAGTTATGTCTACTTCATATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007993.1-442s1c1
Sequence:CCGGCCTGGTGGAAATCAGTGTATTCTCGAGAATACACTGATTTCCACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007993.1-5486s1c1
Sequence:CCGGGCTTCGTGATTGACATTTATACTCGAGTATAAATGTCAATCACGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007993.2-7584s21c1
Sequence:CCGGCTGGCTACACTCCGGATATAACTCGAGTTATATCCGGAGTGTAGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007993.2-3866s21c1
Sequence:CCGGAGGCTCTTCTGTGTCGATATTCTCGAGAATATCGACACAGAAGAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007993.2-457s21c1
Sequence:CCGGTGTCTGTGGATCACGTTATAACTCGAGTTATAACGTGATCCACAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339464    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007993.2-9119s21c1
Sequence:CCGGGCTACCCTGTCATGCGTATTGCTCGAGCAATACGCATGACAGGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007993.2-4352s21c1
Sequence:CCGGTGGATTGGAGACGGCATTAAGCTCGAGCTTAATGCCGTCTCCAATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007993.2-5030s21c1
Sequence:CCGGGTGAACACATCTGAGTATAAACTCGAGTTTATACTCAGATGTGTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377027    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007993.2-8947s21c1
Sequence:CCGGACCTTAGGCAGGTAGAATTATCTCGAGATAATTCTACCTGCCTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000138
VALIDATED
FBN1 MISSION shRNA Bacterial Glycerol Stock
fibrillin 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000055893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000138.2-5159s1c1
Sequence:CCGGCCAGACTACATGCAAGTGAATCTCGAGATTCACTTGCATGTAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_000138.2-2510s1c1
Sequence:CCGGCCCAAGGGATTTATCTACAAACTCGAGTTTGTAGATAAATCCCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_000138.2-3687s1c1
Sequence:CCGGGCTACCATTCAACTCCCGATACTCGAGTATCGGGAGTTGAATGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_000138.2-7695s1c1
Sequence:CCGGCCTGCATTGATAACAATGAATCTCGAGATTCATTGTTATCAATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_000138.2-356s1c1
Sequence:CCGGCCTGGCGGAAATCAGTGTATTCTCGAGAATACACTGATTTCCGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294020    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_000138.3-9352s21c1
Sequence:CCGGTACCTATTTGGTGCTAGTAAACTCGAGTTTACTAGCACCAAATAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_000138.3-7890s21c1
Sequence:CCGGCCTGCATTGATAACAATGAATCTCGAGATTCATTGTTATCAATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_000138.3-2705s21c1
Sequence:CCGGCCCAAGGGATTTATCTACAAACTCGAGTTTGTAGATAAATCCCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_000138.3-551s21c1
Sequence:CCGGCCTGGCGGAAATCAGTGTATTCTCGAGAATACACTGATTTCCGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_000138.3-5608s21c1
Sequence:CCGGTACCGGTTTACCCGTTGATATCTCGAGATATCAACGGGTAAACCGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000138
VALIDATED
FBN1 MISSION shRNA shRNA Plasmid DNA
fibrillin 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000055893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000138.2-5159s1c1
Sequence:CCGGCCAGACTACATGCAAGTGAATCTCGAGATTCACTTGCATGTAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_000138.2-2510s1c1
Sequence:CCGGCCCAAGGGATTTATCTACAAACTCGAGTTTGTAGATAAATCCCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_000138.2-3687s1c1
Sequence:CCGGGCTACCATTCAACTCCCGATACTCGAGTATCGGGAGTTGAATGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_000138.2-7695s1c1
Sequence:CCGGCCTGCATTGATAACAATGAATCTCGAGATTCATTGTTATCAATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_000138.2-356s1c1
Sequence:CCGGCCTGGCGGAAATCAGTGTATTCTCGAGAATACACTGATTTCCGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294020    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_000138.3-9352s21c1
Sequence:CCGGTACCTATTTGGTGCTAGTAAACTCGAGTTTACTAGCACCAAATAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_000138.3-7890s21c1
Sequence:CCGGCCTGCATTGATAACAATGAATCTCGAGATTCATTGTTATCAATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_000138.3-2705s21c1
Sequence:CCGGCCCAAGGGATTTATCTACAAACTCGAGTTTGTAGATAAATCCCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_000138.3-551s21c1
Sequence:CCGGCCTGGCGGAAATCAGTGTATTCTCGAGAATACACTGATTTCCGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_000138.3-5608s21c1
Sequence:CCGGTACCGGTTTACCCGTTGATATCTCGAGATATCAACGGGTAAACCGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000138
VALIDATED
FBN1 MISSION shRNA Lentiviral Transduction Particles
fibrillin 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000055893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000138.2-5159s1c1
Sequence:CCGGCCAGACTACATGCAAGTGAATCTCGAGATTCACTTGCATGTAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_000138.2-2510s1c1
Sequence:CCGGCCCAAGGGATTTATCTACAAACTCGAGTTTGTAGATAAATCCCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_000138.2-3687s1c1
Sequence:CCGGGCTACCATTCAACTCCCGATACTCGAGTATCGGGAGTTGAATGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_000138.2-7695s1c1
Sequence:CCGGCCTGCATTGATAACAATGAATCTCGAGATTCATTGTTATCAATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_000138.2-356s1c1
Sequence:CCGGCCTGGCGGAAATCAGTGTATTCTCGAGAATACACTGATTTCCGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294020    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_000138.3-9352s21c1
Sequence:CCGGTACCTATTTGGTGCTAGTAAACTCGAGTTTACTAGCACCAAATAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_000138.3-7890s21c1
Sequence:CCGGCCTGCATTGATAACAATGAATCTCGAGATTCATTGTTATCAATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_000138.3-2705s21c1
Sequence:CCGGCCCAAGGGATTTATCTACAAACTCGAGTTTGTAGATAAATCCCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_000138.3-551s21c1
Sequence:CCGGCCTGGCGGAAATCAGTGTATTCTCGAGAATACACTGATTTCCGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_000138.3-5608s21c1
Sequence:CCGGTACCGGTTTACCCGTTGATATCTCGAGATATCAACGGGTAAACCGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks