EMAIL THIS PAGE TO A FRIEND

FBN2

fibrillin 2

Synonyms: CCA DA9
UniProtKB ID: P35556, B4DU01, Q59ES6
Gene ID:
Human(2201) Summary: The protein encoded by this gene is a component of connective tissue microfibrils and may be involved in elastic fiber assembly. Mutations in this gene cause congenital contractural arachnodactyly. [provided by RefSeq, Jul 2008]
Mouse(14119) fibrillin 2
Rat(689008) fibrillin 2
sheep(101104991) fibrillin 2
Zebrafish(562634) fibrillin 2
chicken(374203) fibrillin 2
cow(540017) fibrillin 2
Horse(100073031) fibrillin 2
dog(481491) fibrillin 2
179 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001999 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001999 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001999 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010181 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010181 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010181 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001999 Rosetta Predictions human pricing
NM_031826 Rosetta Predictions rat pricing
NM_010181 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001999 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00239462 predicted 5473
2 SASI_Hs01_00239463 predicted 5895
3 SASI_Hs01_00239465 predicted 4423
4 SASI_Hs01_00239467 predicted 8153
5 SASI_Hs01_00239468 predicted 1991
6 SASI_Hs01_00239469 predicted 6008
7 SASI_Hs01_00239470 predicted 2061
8 SASI_Hs01_00239471 predicted 5914
9 SASI_Hs02_00332993 predicted 2303
10 SASI_Hs02_00332994 predicted 6194
11 SASI_Hs01_00239464 predicted 2924
12 SASI_Hs01_00239466 predicted 4107
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031826 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00082075 predicted 2450
2 SASI_Rn02_00265301 predicted 4912
3 SASI_Rn01_00082077 predicted 7083
4 SASI_Rn01_00082078 predicted 4613
5 SASI_Rn02_00265302 predicted 5950
6 SASI_Rn01_00082080 predicted 1545
7 SASI_Rn02_00265303 predicted 3220
8 SASI_Rn01_00082082 predicted 270
9 SASI_Rn01_00082083 predicted 5982
10 SASI_Rn01_00082084 predicted 1637
11 SASI_Rn01_00082076 predicted 4201
12 SASI_Rn01_00082079 predicted 2846
13 SASI_Rn01_00082081 predicted 4286
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010181 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00132830 predicted 6000
2 SASI_Mm02_00317971 predicted 1847
3 SASI_Mm01_00132831 predicted 4205
4 SASI_Mm01_00132832 predicted 5682
5 SASI_Mm01_00132833 predicted 6107
6 SASI_Mm01_00132835 predicted 1962
7 SASI_Mm01_00132836 predicted 3814
8 SASI_Mm01_00132837 predicted 1668
9 SASI_Mm01_00132838 predicted 1912
10 SASI_Mm01_00132839 predicted 7473
11 SASI_Mm01_00132834 predicted 4099
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001999
VALIDATED
FBN2 MISSION shRNA Bacterial Glycerol Stock
fibrillin 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435155    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001999.3-9377s21c1
Sequence:CCGGGCAACCGTGGTTACTGTATTTCTCGAGAAATACAGTAACCACGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427245    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001999.3-9322s21c1
Sequence:CCGGCCTCACAGGGAGGGATAATTTCTCGAGAAATTATCCCTCCCTGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001999.3-2092s21c1
Sequence:CCGGCACACCTGGTTCCTATTATTGCTCGAGCAATAATAGGAACCAGGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001999.3-1995s21c1
Sequence:CCGGGTGAATGCAACATGGGTTATACTCGAGTATAACCCATGTTGCATTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001999.2-8592s1c1
Sequence:CCGGCGGCACATACACACTGGAAATCTCGAGATTTCCAGTGTGTATGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001999.2-6736s1c1
Sequence:CCGGCCCATGATGAATTGTGAAGATCTCGAGATCTTCACAATTCATCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001999.2-5663s1c1
Sequence:CCGGCCTGTGTAGATCGCAATGAATCTCGAGATTCATTGCGATCTACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001999.2-2359s1c1
Sequence:CCGGCGTGGTAGTTACCGTTGTAATCTCGAGATTACAACGGTAACTACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001999.2-962s1c1
Sequence:CCGGGCAGCATCATTCCTGGGATATCTCGAGATATCCCAGGAATGATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001999
VALIDATED
FBN2 MISSION shRNA shRNA Plasmid DNA
fibrillin 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435155    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001999.3-9377s21c1
Sequence:CCGGGCAACCGTGGTTACTGTATTTCTCGAGAAATACAGTAACCACGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427245    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001999.3-9322s21c1
Sequence:CCGGCCTCACAGGGAGGGATAATTTCTCGAGAAATTATCCCTCCCTGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001999.3-2092s21c1
Sequence:CCGGCACACCTGGTTCCTATTATTGCTCGAGCAATAATAGGAACCAGGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001999.3-1995s21c1
Sequence:CCGGGTGAATGCAACATGGGTTATACTCGAGTATAACCCATGTTGCATTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001999.2-8592s1c1
Sequence:CCGGCGGCACATACACACTGGAAATCTCGAGATTTCCAGTGTGTATGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001999.2-6736s1c1
Sequence:CCGGCCCATGATGAATTGTGAAGATCTCGAGATCTTCACAATTCATCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001999.2-5663s1c1
Sequence:CCGGCCTGTGTAGATCGCAATGAATCTCGAGATTCATTGCGATCTACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001999.2-2359s1c1
Sequence:CCGGCGTGGTAGTTACCGTTGTAATCTCGAGATTACAACGGTAACTACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001999.2-962s1c1
Sequence:CCGGGCAGCATCATTCCTGGGATATCTCGAGATATCCCAGGAATGATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001999
VALIDATED
FBN2 MISSION shRNA Lentiviral Transduction Particles
fibrillin 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435155    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001999.3-9377s21c1
Sequence:CCGGGCAACCGTGGTTACTGTATTTCTCGAGAAATACAGTAACCACGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427245    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001999.3-9322s21c1
Sequence:CCGGCCTCACAGGGAGGGATAATTTCTCGAGAAATTATCCCTCCCTGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001999.3-2092s21c1
Sequence:CCGGCACACCTGGTTCCTATTATTGCTCGAGCAATAATAGGAACCAGGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001999.3-1995s21c1
Sequence:CCGGGTGAATGCAACATGGGTTATACTCGAGTATAACCCATGTTGCATTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001999.2-8592s1c1
Sequence:CCGGCGGCACATACACACTGGAAATCTCGAGATTTCCAGTGTGTATGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001999.2-6736s1c1
Sequence:CCGGCCCATGATGAATTGTGAAGATCTCGAGATCTTCACAATTCATCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001999.2-5663s1c1
Sequence:CCGGCCTGTGTAGATCGCAATGAATCTCGAGATTCATTGCGATCTACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001999.2-2359s1c1
Sequence:CCGGCGTGGTAGTTACCGTTGTAATCTCGAGATTACAACGGTAACTACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001999.2-962s1c1
Sequence:CCGGGCAGCATCATTCCTGGGATATCTCGAGATATCCCAGGAATGATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010181
FBN2 MISSION shRNA Bacterial Glycerol Stock
fibrillin 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000109470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010181.1-5140s1c1
Sequence:CCGGCCTGAGTACATGCAAGTCAATCTCGAGATTGACTTGCATGTACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010181.1-1455s1c1
Sequence:CCGGCCAGACAATAGACATCTGTAACTCGAGTTACAGATGTCTATTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010181.1-2844s1c1
Sequence:CCGGCGTTAATGAATGCGAGGTGTTCTCGAGAACACCTCGCATTCATTAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010181.1-644s1c1
Sequence:CCGGCGTGTTTCACTCAAGTCAATACTCGAGTATTGACTTGAGTGAAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010181.1-5139s1c1
Sequence:CCGGGCCTGAGTACATGCAAGTCAACTCGAGTTGACTTGCATGTACTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010181
FBN2 MISSION shRNA shRNA Plasmid DNA
fibrillin 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000109470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010181.1-5140s1c1
Sequence:CCGGCCTGAGTACATGCAAGTCAATCTCGAGATTGACTTGCATGTACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010181.1-1455s1c1
Sequence:CCGGCCAGACAATAGACATCTGTAACTCGAGTTACAGATGTCTATTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010181.1-2844s1c1
Sequence:CCGGCGTTAATGAATGCGAGGTGTTCTCGAGAACACCTCGCATTCATTAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010181.1-644s1c1
Sequence:CCGGCGTGTTTCACTCAAGTCAATACTCGAGTATTGACTTGAGTGAAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010181.1-5139s1c1
Sequence:CCGGGCCTGAGTACATGCAAGTCAACTCGAGTTGACTTGCATGTACTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010181
FBN2 MISSION shRNA Lentiviral Transduction Particles
fibrillin 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000109470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010181.1-5140s1c1
Sequence:CCGGCCTGAGTACATGCAAGTCAATCTCGAGATTGACTTGCATGTACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010181.1-1455s1c1
Sequence:CCGGCCAGACAATAGACATCTGTAACTCGAGTTACAGATGTCTATTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010181.1-2844s1c1
Sequence:CCGGCGTTAATGAATGCGAGGTGTTCTCGAGAACACCTCGCATTCATTAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010181.1-644s1c1
Sequence:CCGGCGTGTTTCACTCAAGTCAATACTCGAGTATTGACTTGAGTGAAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010181.1-5139s1c1
Sequence:CCGGGCCTGAGTACATGCAAGTCAACTCGAGTTGACTTGCATGTACTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks