EMAIL THIS PAGE TO A FRIEND

FBN3

fibrillin 3

37 Gene Product Result for
UniProtKB ID: Q75N90, Q75N91, Q75N92, Q75N93, Q86SJ5, Q96JP8
Gene ID:
Human(84467) Summary: This gene encodes a protein that belongs to the fibrillin gene family. Fibrillins are extracellular matrix molecules that assemble into microfibrils in many connective tissues. This gene is most highly expressed in fetal tissues and its protein product is localized to extracellular microfibrils of developing skeletal elements, skin, lung, kidney, and skeletal muscle. This gene is potentially involved in Weill-Marchesani syndrome. While several transcript variants may exist for this gene, their full-length natures have not been described to date. [provided by RefSeq, Jul 2008]
chicken(395079) fibrillin 3
cow(787458) fibrillin 3
dog(485006) fibrillin 3
sheep(101103811) fibrillin 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032447 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032447 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032447 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU068531 MISSION® esiRNA esiRNA human FBN3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032447 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032447 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00233401 predicted 1243
2 SASI_Hs02_00359859 predicted 1315
3 SASI_Hs01_00233403 predicted 5709
4 SASI_Hs02_00359860 predicted 1596
5 SASI_Hs01_00233404 predicted 7258
6 SASI_Hs01_00233405 predicted 5637
7 SASI_Hs01_00233406 predicted 6459
8 SASI_Hs01_00233408 predicted 6299
9 SASI_Hs02_00359861 predicted 4985
10 SASI_Hs01_00233409 predicted 2219
11 SASI_Hs01_00233402 predicted 6377
12 SASI_Hs01_00233407 predicted 2772
13 SASI_Hs01_00233410 predicted 3026
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032447
FBN3 MISSION shRNA Bacterial Glycerol Stock
fibrillin 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000053278    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032447.2-8944s1c1
Sequence:CCGGCCGAAACTCAGGAAGAGTGAACTCGAGTTCACTCTTCCTGAGTTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032447.2-6667s1c1
Sequence:CCGGCGTGAATGAGTGTGCAGAGAACTCGAGTTCTCTGCACACTCATTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032447.2-1639s1c1
Sequence:CCGGCATTGACATCTGCCGACACTTCTCGAGAAGTGTCGGCAGATGTCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032447.2-7658s1c1
Sequence:CCGGCCATGTACCTTCCTCTGCAAACTCGAGTTTGCAGAGGAAGGTACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032447.2-7161s1c1
Sequence:CCGGGCTGCACAGATGACAATGAATCTCGAGATTCATTGTCATCTGTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032447.3-5233s21c1
Sequence:CCGGATAAACCAGATCGGGAGTTTCCTCGAGGAAACTCCCGATCTGGTTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032447.3-8039s21c1
Sequence:CCGGGCTACGAATGCAAGATCAATGCTCGAGCATTGATCTTGCATTCGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032447.3-4973s21c1
Sequence:CCGGGTGTCTGCTTCCGGCACTATACTCGAGTATAGTGCCGGAAGCAGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032447
FBN3 MISSION shRNA shRNA Plasmid DNA
fibrillin 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000053278    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032447.2-8944s1c1
Sequence:CCGGCCGAAACTCAGGAAGAGTGAACTCGAGTTCACTCTTCCTGAGTTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032447.2-6667s1c1
Sequence:CCGGCGTGAATGAGTGTGCAGAGAACTCGAGTTCTCTGCACACTCATTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032447.2-1639s1c1
Sequence:CCGGCATTGACATCTGCCGACACTTCTCGAGAAGTGTCGGCAGATGTCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032447.2-7658s1c1
Sequence:CCGGCCATGTACCTTCCTCTGCAAACTCGAGTTTGCAGAGGAAGGTACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032447.2-7161s1c1
Sequence:CCGGGCTGCACAGATGACAATGAATCTCGAGATTCATTGTCATCTGTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032447.3-5233s21c1
Sequence:CCGGATAAACCAGATCGGGAGTTTCCTCGAGGAAACTCCCGATCTGGTTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032447.3-8039s21c1
Sequence:CCGGGCTACGAATGCAAGATCAATGCTCGAGCATTGATCTTGCATTCGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032447.3-4973s21c1
Sequence:CCGGGTGTCTGCTTCCGGCACTATACTCGAGTATAGTGCCGGAAGCAGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032447
FBN3 MISSION shRNA Lentiviral Transduction Particles
fibrillin 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000053278    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032447.2-8944s1c1
Sequence:CCGGCCGAAACTCAGGAAGAGTGAACTCGAGTTCACTCTTCCTGAGTTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032447.2-6667s1c1
Sequence:CCGGCGTGAATGAGTGTGCAGAGAACTCGAGTTCTCTGCACACTCATTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032447.2-1639s1c1
Sequence:CCGGCATTGACATCTGCCGACACTTCTCGAGAAGTGTCGGCAGATGTCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032447.2-7658s1c1
Sequence:CCGGCCATGTACCTTCCTCTGCAAACTCGAGTTTGCAGAGGAAGGTACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032447.2-7161s1c1
Sequence:CCGGGCTGCACAGATGACAATGAATCTCGAGATTCATTGTCATCTGTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032447.3-5233s21c1
Sequence:CCGGATAAACCAGATCGGGAGTTTCCTCGAGGAAACTCCCGATCTGGTTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032447.3-8039s21c1
Sequence:CCGGGCTACGAATGCAAGATCAATGCTCGAGCATTGATCTTGCATTCGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032447.3-4973s21c1
Sequence:CCGGGTGTCTGCTTCCGGCACTATACTCGAGTATAGTGCCGGAAGCAGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks