EMAIL THIS PAGE TO A FRIEND

FBP1

fructose-1,6-bisphosphatase 1

70 Gene Product Result for
Synonyms: FBP
UniProtKB ID: P09467, O75571, Q53F94, Q96E46
Gene ID:
Human(2203) Summary: Fructose-1,6-bisphosphatase 1, a gluconeogenesis regulatory enzyme, catalyzes the hydrolysis of fructose 1,6-bisphosphate to fructose 6-phosphate and inorganic phosphate. Fructose-1,6-diphosphatase deficiency is associated with hypoglycemia and metabolic acidosis. [provided by RefSeq, Jul 2008]
Mouse(14121) fructose bisphosphatase 1
Rat(24362) fructose-1,6-bisphosphatase 1
fruit fly(39566) Fat body protein 1
domestic cat(101084832) fructose-1,6-bisphosphatase 1
cow(513483) fructose-1,6-bisphosphatase 1
dog(476299) fructose-1,6-bisphosphatase 1
chicken(395218) fructose-1,6-bisphosphatase 1
naked mole-rat(101708632) fructose-1,6-bisphosphatase 1
domestic guinea pig(100731650) fructose-1,6-bisphosphatase 1
sheep(101113198) fructose-1,6-bisphosphatase 1
Domestic Rabbit(100008863) fructose-1,6-bisphosphatase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000507 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000507 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000507 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019395 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019395 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019395 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000507 Rosetta Predictions human pricing
NM_001127628 Rosetta Predictions human pricing
NM_012558 Rosetta Predictions rat pricing
NM_019395 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000507 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00140811 predicted 517
2 SASI_Hs01_00140813 predicted 565
3 SASI_Hs01_00140815 predicted 756
4 SASI_Hs01_00140816 predicted 843
5 SASI_Hs01_00140817 predicted 501
6 SASI_Hs01_00140818 predicted 568
7 SASI_Hs01_00140819 predicted 1096
8 SASI_Hs02_00302690 predicted 600
9 SASI_Hs02_00302691 predicted 1229
10 SASI_Hs01_00140820 predicted 1239
11 SASI_Hs01_00140812 predicted 385
12 SASI_Hs01_00140814 predicted 224
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127628 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00329904 predicted 412
2 SASI_Hs02_00329905 predicted 462
3 SASI_Hs02_00329906 predicted 655
4 SASI_Hs02_00329907 predicted 744
5 SASI_Hs02_00329908 predicted 470
6 SASI_Hs02_00329909 predicted 498
7 SASI_Hs02_00329910 predicted 997
8 SASI_Hs02_00329911 predicted 495
9 SASI_Hs02_00329912 predicted 1127
10 SASI_Hs02_00329913 predicted 1133
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012558 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00118474 predicted 870
2 SASI_Rn01_00118475 predicted 550
3 SASI_Rn01_00118477 predicted 644
4 SASI_Rn02_00259669 predicted 506
5 SASI_Rn01_00118479 predicted 442
6 SASI_Rn01_00118480 predicted 883
7 SASI_Rn01_00118481 predicted 845
8 SASI_Rn01_00118482 predicted 1196
9 SASI_Rn01_00118483 predicted 981
10 SASI_Rn02_00259670 predicted 777
11 SASI_Rn01_00118476 predicted 477
12 SASI_Rn01_00118478 predicted 836
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019395 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00174601 predicted 956
2 SASI_Mm01_00174602 predicted 620
3 SASI_Mm01_00174603 predicted 956
4 SASI_Mm01_00174604 predicted 841
5 SASI_Mm01_00174605 predicted 814
6 SASI_Mm01_00174606 predicted 365
7 SASI_Mm01_00174607 predicted 928
8 SASI_Mm01_00174608 predicted 851
9 SASI_Mm01_00174609 predicted 1009
10 SASI_Mm01_00174610 predicted 935
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000507
VALIDATED
FBP1 MISSION shRNA Bacterial Glycerol Stock
fructose-1,6-bisphosphatase 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000298951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000507.3-691s21c1
Sequence:CCGGCCTTGATGGATCTTCCAACATCTCGAGATGTTGGAAGATCCATCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298878    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000507.3-1472s21c1
Sequence:CCGGCCACCATCAAATGCTGTAGAACTCGAGTTCTACAGCATTTGATGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000507.3-450s21c1
Sequence:CCGGCAGCAGTCAAAGCCATCTCTTCTCGAGAAGAGATGGCTTTGACTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000507.3-568s21c1
Sequence:CCGGCGACCTGGTTATGAACATGTTCTCGAGAACATGTTCATAACCAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050033    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000507.2-1352s1c1
Sequence:CCGGCCACCATCAAATGCTGTAGAACTCGAGTTCTACAGCATTTGATGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000507.2-571s1c1
Sequence:CCGGCCTTGATGGATCTTCCAACATCTCGAGATGTTGGAAGATCCATCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000507.2-448s1c1
Sequence:CCGGCGACCTGGTTATGAACATGTTCTCGAGAACATGTTCATAACCAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000507.2-330s1c1
Sequence:CCGGCAGCAGTCAAAGCCATCTCTTCTCGAGAAGAGATGGCTTTGACTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000507.2-913s1c1
Sequence:CCGGCCCAGATAATTCAGCTCCTTACTCGAGTAAGGAGCTGAATTATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000507
VALIDATED
FBP1 MISSION shRNA shRNA Plasmid DNA
fructose-1,6-bisphosphatase 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000298951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000507.3-691s21c1
Sequence:CCGGCCTTGATGGATCTTCCAACATCTCGAGATGTTGGAAGATCCATCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298878    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000507.3-1472s21c1
Sequence:CCGGCCACCATCAAATGCTGTAGAACTCGAGTTCTACAGCATTTGATGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000507.3-450s21c1
Sequence:CCGGCAGCAGTCAAAGCCATCTCTTCTCGAGAAGAGATGGCTTTGACTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000507.3-568s21c1
Sequence:CCGGCGACCTGGTTATGAACATGTTCTCGAGAACATGTTCATAACCAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050033    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000507.2-1352s1c1
Sequence:CCGGCCACCATCAAATGCTGTAGAACTCGAGTTCTACAGCATTTGATGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000507.2-571s1c1
Sequence:CCGGCCTTGATGGATCTTCCAACATCTCGAGATGTTGGAAGATCCATCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000507.2-448s1c1
Sequence:CCGGCGACCTGGTTATGAACATGTTCTCGAGAACATGTTCATAACCAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000507.2-330s1c1
Sequence:CCGGCAGCAGTCAAAGCCATCTCTTCTCGAGAAGAGATGGCTTTGACTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000507.2-913s1c1
Sequence:CCGGCCCAGATAATTCAGCTCCTTACTCGAGTAAGGAGCTGAATTATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000507
VALIDATED
FBP1 MISSION shRNA Lentiviral Transduction Particles
fructose-1,6-bisphosphatase 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000298951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000507.3-691s21c1
Sequence:CCGGCCTTGATGGATCTTCCAACATCTCGAGATGTTGGAAGATCCATCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298878    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000507.3-1472s21c1
Sequence:CCGGCCACCATCAAATGCTGTAGAACTCGAGTTCTACAGCATTTGATGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000507.3-450s21c1
Sequence:CCGGCAGCAGTCAAAGCCATCTCTTCTCGAGAAGAGATGGCTTTGACTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000507.3-568s21c1
Sequence:CCGGCGACCTGGTTATGAACATGTTCTCGAGAACATGTTCATAACCAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050033    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000507.2-1352s1c1
Sequence:CCGGCCACCATCAAATGCTGTAGAACTCGAGTTCTACAGCATTTGATGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000507.2-571s1c1
Sequence:CCGGCCTTGATGGATCTTCCAACATCTCGAGATGTTGGAAGATCCATCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000507.2-448s1c1
Sequence:CCGGCGACCTGGTTATGAACATGTTCTCGAGAACATGTTCATAACCAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000507.2-330s1c1
Sequence:CCGGCAGCAGTCAAAGCCATCTCTTCTCGAGAAGAGATGGCTTTGACTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000507.2-913s1c1
Sequence:CCGGCCCAGATAATTCAGCTCCTTACTCGAGTAAGGAGCTGAATTATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019395
FBP1 MISSION shRNA Bacterial Glycerol Stock
fructose-1,6-bisphosphatase 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000081143    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019395.1-1296s1c1
Sequence:CCGGCGTGGATAGTTTCACAGCTTACTCGAGTAAGCTGTGAAACTATCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019395.1-817s1c1
Sequence:CCGGCTACAGCCTTAATGAGGGTTACTCGAGTAACCCTCATTAAGGCTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019395.1-498s1c1
Sequence:CCGGCCATCATAATCGAACCTGAGACTCGAGTCTCAGGTTCGATTATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019395.1-398s1c1
Sequence:CCGGCAAGTAAAGAAGCTGGACATACTCGAGTATGTCCAGCTTCTTTACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019395.1-1042s1c1
Sequence:CCGGCATAGCTTATGTCATGGAGAACTCGAGTTCTCCATGACATAAGCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019395
FBP1 MISSION shRNA shRNA Plasmid DNA
fructose-1,6-bisphosphatase 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000081143    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019395.1-1296s1c1
Sequence:CCGGCGTGGATAGTTTCACAGCTTACTCGAGTAAGCTGTGAAACTATCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019395.1-817s1c1
Sequence:CCGGCTACAGCCTTAATGAGGGTTACTCGAGTAACCCTCATTAAGGCTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019395.1-498s1c1
Sequence:CCGGCCATCATAATCGAACCTGAGACTCGAGTCTCAGGTTCGATTATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019395.1-398s1c1
Sequence:CCGGCAAGTAAAGAAGCTGGACATACTCGAGTATGTCCAGCTTCTTTACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019395.1-1042s1c1
Sequence:CCGGCATAGCTTATGTCATGGAGAACTCGAGTTCTCCATGACATAAGCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019395
FBP1 MISSION shRNA Lentiviral Transduction Particles
fructose-1,6-bisphosphatase 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000081143    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019395.1-1296s1c1
Sequence:CCGGCGTGGATAGTTTCACAGCTTACTCGAGTAAGCTGTGAAACTATCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019395.1-817s1c1
Sequence:CCGGCTACAGCCTTAATGAGGGTTACTCGAGTAACCCTCATTAAGGCTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019395.1-498s1c1
Sequence:CCGGCCATCATAATCGAACCTGAGACTCGAGTCTCAGGTTCGATTATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019395.1-398s1c1
Sequence:CCGGCAAGTAAAGAAGCTGGACATACTCGAGTATGTCCAGCTTCTTTACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019395.1-1042s1c1
Sequence:CCGGCATAGCTTATGTCATGGAGAACTCGAGTTCTCCATGACATAAGCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks