EMAIL THIS PAGE TO A FRIEND

FBRS

fibrosin

119 Gene Product Result for
Synonyms: FBS FBS1
UniProtKB ID: Q9HAH7, B4DP86, Q96CI9, Q9H9X4
Gene ID:
Human(64319) Summary: Fibrosin is a lymphokine secreted by activated lymphocytes that induces fibroblast proliferation (Prakash and Robbins, 1998 [PubMed 9809749]
Mouse(14123) fibrosin
Rat(691899) fibrosin
cow(615050) fibrosin
dog(607426) fibrosin
sheep(101103943) fibrosin
Gene Class: Cytokines_and_Chemokines
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010183 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010183 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010183 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_022452 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022452 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022452 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU152651 MISSION® esiRNA esiRNA human FBRS (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001105079 Rosetta Predictions human pricing
NM_022452 Rosetta Predictions human pricing
XM_001080034 Rosetta Predictions rat pricing
XM_284344 Rosetta Predictions mouse pricing
XM_916901 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105079 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00323884 predicted 2004
2 SASI_Hs02_00323885 predicted 480
3 SASI_Hs02_00323886 predicted 786
4 SASI_Hs02_00323887 predicted 547
5 SASI_Hs02_00323888 predicted 773
6 SASI_Hs02_00323889 predicted 1808
7 SASI_Hs02_00323890 predicted 1811
8 SASI_Hs02_00323891 predicted 572
9 SASI_Hs02_00323892 predicted 1694
10 SASI_Hs02_00323893 predicted 1389
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022452 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00226599 predicted 284
2 SASI_Hs01_00226600 predicted 491
3 SASI_Hs01_00226601 predicted 293
4 SASI_Hs01_00226602 predicted 1708
5 SASI_Hs01_00226603 predicted 479
6 SASI_Hs01_00226604 predicted 1516
7 SASI_Hs01_00226605 predicted 1524
8 SASI_Hs01_00226606 predicted 1096
9 SASI_Hs01_00226607 predicted 797
10 SASI_Hs01_00226608 predicted 1469
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080034 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00366309 predicted 744
2 SASI_Rn02_00366310 predicted 756
3 SASI_Rn02_00366311 predicted 617
4 SASI_Rn02_00366312 predicted 755
5 SASI_Rn02_00366313 predicted 1747
6 SASI_Rn02_00366314 predicted 1857
7 SASI_Rn02_00366315 predicted 1748
8 SASI_Rn02_00366316 predicted 503
9 SASI_Rn02_00366317 predicted 1817
10 SASI_Rn02_00366318 predicted 747
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_284344 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00241166 predicted 2916
2 SASI_Mm01_00241169 predicted 2112
3 SASI_Mm01_00241170 predicted 2190
4 SASI_Mm02_00425649 predicted 2288
5 SASI_Mm01_00241171 predicted 1996
6 SASI_Mm01_00241172 predicted 2004
7 SASI_Mm01_00241173 predicted 2126
8 SASI_Mm01_00241174 predicted 2127
9 SASI_Mm02_00425650 predicted 2016
10 SASI_Mm02_00425651 predicted 2958
11 SASI_Mm01_00241167 predicted 2950
12 SASI_Mm01_00241168 predicted 2954
13 SASI_Mm01_00241175 predicted 2417
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_916901 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00440711 predicted 2958
2 SASI_Mm02_00440712 predicted 867
3 SASI_Mm02_00440713 predicted 865
4 SASI_Mm02_00440714 predicted 2158
5 SASI_Mm02_00440715 predicted 2237
6 SASI_Mm02_00440716 predicted 660
7 SASI_Mm02_00440717 predicted 2006
8 SASI_Mm02_00440718 predicted 2042
9 SASI_Mm02_00440719 predicted 3533
10 SASI_Mm02_00440720 predicted 1993
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010183
VALIDATED
FBRS MISSION shRNA Bacterial Glycerol Stock
fibrosin
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000352581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010183.1-1235s21c1
Sequence:CCGGCCTGCTCATCCACTGCTATACCTCGAGGTATAGCAGTGGATGAGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010183.1-226s21c1
Sequence:CCGGGACACAGATCCCTGATCATTTCTCGAGAAATGATCAGGGATCTGTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010183.1-522s21c1
Sequence:CCGGGTACCCACATTGATCCCTTTGCTCGAGCAAAGGGATCAATGTGGGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010183.1-910s21c1
Sequence:CCGGCAAAGAGTCTGTGCGGGTAAACTCGAGTTTACCCGCACAGACTCTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341859    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010183.1-1899s21c1
Sequence:CCGGGGGTTTCATGTACATATTTATCTCGAGATAAATATGTACATGAAACCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010183
VALIDATED
FBRS MISSION shRNA shRNA Plasmid DNA
fibrosin
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000352581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010183.1-1235s21c1
Sequence:CCGGCCTGCTCATCCACTGCTATACCTCGAGGTATAGCAGTGGATGAGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010183.1-226s21c1
Sequence:CCGGGACACAGATCCCTGATCATTTCTCGAGAAATGATCAGGGATCTGTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010183.1-522s21c1
Sequence:CCGGGTACCCACATTGATCCCTTTGCTCGAGCAAAGGGATCAATGTGGGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010183.1-910s21c1
Sequence:CCGGCAAAGAGTCTGTGCGGGTAAACTCGAGTTTACCCGCACAGACTCTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341859    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010183.1-1899s21c1
Sequence:CCGGGGGTTTCATGTACATATTTATCTCGAGATAAATATGTACATGAAACCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010183
VALIDATED
FBRS MISSION shRNA Lentiviral Transduction Particles
fibrosin
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000352581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010183.1-1235s21c1
Sequence:CCGGCCTGCTCATCCACTGCTATACCTCGAGGTATAGCAGTGGATGAGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010183.1-226s21c1
Sequence:CCGGGACACAGATCCCTGATCATTTCTCGAGAAATGATCAGGGATCTGTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010183.1-522s21c1
Sequence:CCGGGTACCCACATTGATCCCTTTGCTCGAGCAAAGGGATCAATGTGGGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010183.1-910s21c1
Sequence:CCGGCAAAGAGTCTGTGCGGGTAAACTCGAGTTTACCCGCACAGACTCTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341859    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_010183.1-1899s21c1
Sequence:CCGGGGGTTTCATGTACATATTTATCTCGAGATAAATATGTACATGAAACCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022452
FBRS MISSION shRNA Bacterial Glycerol Stock
fibrosin
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166572    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022452.1-289s1c1
Sequence:CCGGCCACAAGCTTGACTTTCGGAACTCGAGTTCCGAAAGTCAAGCTTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165892    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022452.1-1436s1c1
Sequence:CCGGGCAAAGGTCATAACCTCACCACTCGAGTGGTGAGGTTATGACCTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165700    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022452.1-296s1c1
Sequence:CCGGCTTGACTTTCGGAATGACCTCCTCGAGGAGGTCATTCCGAAAGTCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165037    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022452.1-295s1c1
Sequence:CCGGGCTTGACTTTCGGAATGACCTCTCGAGAGGTCATTCCGAAAGTCAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163873    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022452.1-290s1c1
Sequence:CCGGCACAAGCTTGACTTTCGGAATCTCGAGATTCCGAAAGTCAAGCTTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165454    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022452.1-860s1c1
Sequence:CCGGGAATCTGTGCGGGTAAAGGAACTCGAGTTCCTTTACCCGCACAGATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166315    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022452.1-1509s1c1
Sequence:CCGGCCAAGCATCACATGGAGTGTACTCGAGTACACTCCATGTGATGCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166465    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022452.1-2116s1c1
Sequence:CCGGCCAAAGGCTCAGCCTCTAAATCTCGAGATTTAGAGGCTGAGCCTTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165760    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022452.1-856s1c1
Sequence:CCGGCAAGGAATCTGTGCGGGTAAACTCGAGTTTACCCGCACAGATTCCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022452
FBRS MISSION shRNA shRNA Plasmid DNA
fibrosin
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166572    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022452.1-289s1c1
Sequence:CCGGCCACAAGCTTGACTTTCGGAACTCGAGTTCCGAAAGTCAAGCTTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165892    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022452.1-1436s1c1
Sequence:CCGGGCAAAGGTCATAACCTCACCACTCGAGTGGTGAGGTTATGACCTTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165700    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022452.1-296s1c1
Sequence:CCGGCTTGACTTTCGGAATGACCTCCTCGAGGAGGTCATTCCGAAAGTCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165037    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022452.1-295s1c1
Sequence:CCGGGCTTGACTTTCGGAATGACCTCTCGAGAGGTCATTCCGAAAGTCAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163873    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022452.1-290s1c1
Sequence:CCGGCACAAGCTTGACTTTCGGAATCTCGAGATTCCGAAAGTCAAGCTTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165454    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022452.1-860s1c1
Sequence:CCGGGAATCTGTGCGGGTAAAGGAACTCGAGTTCCTTTACCCGCACAGATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166315    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022452.1-1509s1c1
Sequence:CCGGCCAAGCATCACATGGAGTGTACTCGAGTACACTCCATGTGATGCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166465    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022452.1-2116s1c1
Sequence:CCGGCCAAAGGCTCAGCCTCTAAATCTCGAGATTTAGAGGCTGAGCCTTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165760    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022452.1-856s1c1
Sequence:CCGGCAAGGAATCTGTGCGGGTAAACTCGAGTTTACCCGCACAGATTCCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022452
FBRS MISSION shRNA Lentiviral Transduction Particles
fibrosin
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166572    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022452.1-289s1c1
Sequence:CCGGCCACAAGCTTGACTTTCGGAACTCGAGTTCCGAAAGTCAAGCTTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165892    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022452.1-1436s1c1
Sequence:CCGGGCAAAGGTCATAACCTCACCACTCGAGTGGTGAGGTTATGACCTTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165700    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022452.1-296s1c1
Sequence:CCGGCTTGACTTTCGGAATGACCTCCTCGAGGAGGTCATTCCGAAAGTCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165037    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022452.1-295s1c1
Sequence:CCGGGCTTGACTTTCGGAATGACCTCTCGAGAGGTCATTCCGAAAGTCAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163873    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022452.1-290s1c1
Sequence:CCGGCACAAGCTTGACTTTCGGAATCTCGAGATTCCGAAAGTCAAGCTTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165454    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022452.1-860s1c1
Sequence:CCGGGAATCTGTGCGGGTAAAGGAACTCGAGTTCCTTTACCCGCACAGATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166315    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022452.1-1509s1c1
Sequence:CCGGCCAAGCATCACATGGAGTGTACTCGAGTACACTCCATGTGATGCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166465    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022452.1-2116s1c1
Sequence:CCGGCCAAAGGCTCAGCCTCTAAATCTCGAGATTTAGAGGCTGAGCCTTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165760    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022452.1-856s1c1
Sequence:CCGGCAAGGAATCTGTGCGGGTAAACTCGAGTTTACCCGCACAGATTCCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)