EMAIL THIS PAGE TO A FRIEND

FBXL12

F-box and leucine-rich repeat protein 12

118 Gene Product Result for
Synonyms: Fbl12
UniProtKB ID: Q9NXK8, B3KSJ8, Q9H5K4
Gene ID:
Human(54850) Summary: Members of the F-box protein family, such as FBXL12, are characterized by an approximately 40-amino acid F-box motif. SCF complexes, formed by SKP1 (MIM 601434), cullin (see CUL1; MIM 603134), and F-box proteins, act as protein-ubiquitin ligases. F-box proteins interact with SKP1 through the F box, and they interact with ubiquitination targets through other protein interaction domains (Jin et al., 2004 [PubMed 15520277]
Mouse(30843) F-box and leucine-rich repeat protein 12
Rat(313782) F-box and leucine-rich repeat protein 12
chicken(396477) F-box and leucine-rich repeat protein 12
domestic cat(101087382) F-box and leucine-rich repeat protein 12
cow(617304) F-box and leucine-rich repeat protein 12
dog(484965) F-box and leucine-rich repeat protein 12
sheep(101110231) F-box and leucine-rich repeat protein 12
naked mole-rat(101707451) F-box and leucine-rich repeat protein 12
domestic guinea pig(100726883) F-box and leucine-rich repeat protein 12
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013911 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013911 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013911 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017703 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017703 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017703 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017703 Rosetta Predictions human pricing
NM_001025700 Rosetta Predictions rat pricing
NM_001002846 Rosetta Predictions mouse pricing
NM_013911 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017703 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00044924 predicted 1068
2 SASI_Hs01_00044925 predicted 398
3 SASI_Hs01_00044926 predicted 385
4 SASI_Hs01_00044927 predicted 396
5 SASI_Hs01_00044928 predicted 984
6 SASI_Hs01_00044929 predicted 839
7 SASI_Hs01_00044930 predicted 388
8 SASI_Hs01_00044931 predicted 570
9 SASI_Hs01_00044932 predicted 370
10 SASI_Hs01_00044933 predicted 321
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025700 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00073826 predicted 1473
2 SASI_Rn01_00073827 predicted 1307
3 SASI_Rn02_00203320 predicted 1242
4 SASI_Rn01_00073829 predicted 1565
5 SASI_Rn01_00073830 predicted 1349
6 SASI_Rn01_00073831 predicted 1336
7 SASI_Rn01_00073832 predicted 1134
8 SASI_Rn01_00073833 predicted 1657
9 SASI_Rn01_00073834 predicted 642
10 SASI_Rn01_00073835 predicted 985
11 SASI_Rn01_00073828 predicted 1599
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002846 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00286300 predicted 1402
2 SASI_Mm02_00286301 predicted 1681
3 SASI_Mm01_00156815 predicted 1814
4 SASI_Mm01_00156816 predicted 1764
5 SASI_Mm01_00156817 predicted 815
6 SASI_Mm01_00156819 predicted 1334
7 SASI_Mm01_00156820 predicted 1496
8 SASI_Mm01_00156822 predicted 1434
9 SASI_Mm01_00156823 predicted 1663
10 SASI_Mm02_00286302 predicted 1033
11 SASI_Mm01_00156814 predicted 1323
12 SASI_Mm01_00156818 predicted 1762
13 SASI_Mm01_00156821 predicted 1758
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013911 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00323006 predicted 1437
2 SASI_Mm01_00075714 predicted 627
3 SASI_Mm01_00075715 predicted 1845
4 SASI_Mm01_00075716 predicted 1800
5 SASI_Mm01_00075717 predicted 848
6 SASI_Mm01_00075719 predicted 607
7 SASI_Mm01_00075720 predicted 1367
8 SASI_Mm01_00075721 predicted 1524
9 SASI_Mm01_00075722 predicted 1459
10 SASI_Mm02_00323007 predicted 1689
11 SASI_Mm01_00075713 predicted 1350
12 SASI_Mm01_00075718 predicted 1790
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013911
VALIDATED
FBXL12 MISSION shRNA Bacterial Glycerol Stock
F-box and leucine-rich repeat protein 12
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000331444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013911.2-855s21c1
Sequence:CCGGACCTGAGCATGGTGCCTATCACTCGAGTGATAGGCACCATGCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013911.2-551s21c1
Sequence:CCGGCTCTTGGAGATCTTCTCTTACCTCGAGGTAAGAGAAGATCTCCAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306173    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013911.2-1723s21c1
Sequence:CCGGTAGCTACCTCATGATTCATTTCTCGAGAAATGAATCATGAGGTAGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013911.2-1468s21c1
Sequence:CCGGTCCCAAAGAATCCATGGATTGCTCGAGCAATCCATGGATTCTTTGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013911.2-1196s21c1
Sequence:CCGGCTTCGAGATGTGCGCAAGATTCTCGAGAATCTTGCGCACATCTCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092618    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013911.2-1695s1c1
Sequence:CCGGCCGTTCACACATTTAGGAATACTCGAGTATTCCTAAATGTGTGAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013911.2-1446s1c1
Sequence:CCGGGCATAGTTATTGTTAGGGCTTCTCGAGAAGCCCTAACAATAACTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013911.2-1196s1c1
Sequence:CCGGCTTCGAGATGTGCGCAAGATTCTCGAGAATCTTGCGCACATCTCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013911.2-919s1c1
Sequence:CCGGCGAAATCTCCATGATCTGGTTCTCGAGAACCAGATCATGGAGATTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013911.2-1440s1c1
Sequence:CCGGCCCACTGCATAGTTATTGTTACTCGAGTAACAATAACTATGCAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013911
VALIDATED
FBXL12 MISSION shRNA shRNA Plasmid DNA
F-box and leucine-rich repeat protein 12
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000331444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013911.2-855s21c1
Sequence:CCGGACCTGAGCATGGTGCCTATCACTCGAGTGATAGGCACCATGCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013911.2-551s21c1
Sequence:CCGGCTCTTGGAGATCTTCTCTTACCTCGAGGTAAGAGAAGATCTCCAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306173    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013911.2-1723s21c1
Sequence:CCGGTAGCTACCTCATGATTCATTTCTCGAGAAATGAATCATGAGGTAGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013911.2-1468s21c1
Sequence:CCGGTCCCAAAGAATCCATGGATTGCTCGAGCAATCCATGGATTCTTTGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013911.2-1196s21c1
Sequence:CCGGCTTCGAGATGTGCGCAAGATTCTCGAGAATCTTGCGCACATCTCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092618    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013911.2-1695s1c1
Sequence:CCGGCCGTTCACACATTTAGGAATACTCGAGTATTCCTAAATGTGTGAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013911.2-1446s1c1
Sequence:CCGGGCATAGTTATTGTTAGGGCTTCTCGAGAAGCCCTAACAATAACTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013911.2-1196s1c1
Sequence:CCGGCTTCGAGATGTGCGCAAGATTCTCGAGAATCTTGCGCACATCTCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013911.2-919s1c1
Sequence:CCGGCGAAATCTCCATGATCTGGTTCTCGAGAACCAGATCATGGAGATTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013911.2-1440s1c1
Sequence:CCGGCCCACTGCATAGTTATTGTTACTCGAGTAACAATAACTATGCAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013911
VALIDATED
FBXL12 MISSION shRNA Lentiviral Transduction Particles
F-box and leucine-rich repeat protein 12
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000331444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013911.2-855s21c1
Sequence:CCGGACCTGAGCATGGTGCCTATCACTCGAGTGATAGGCACCATGCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013911.2-551s21c1
Sequence:CCGGCTCTTGGAGATCTTCTCTTACCTCGAGGTAAGAGAAGATCTCCAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306173    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013911.2-1723s21c1
Sequence:CCGGTAGCTACCTCATGATTCATTTCTCGAGAAATGAATCATGAGGTAGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013911.2-1468s21c1
Sequence:CCGGTCCCAAAGAATCCATGGATTGCTCGAGCAATCCATGGATTCTTTGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013911.2-1196s21c1
Sequence:CCGGCTTCGAGATGTGCGCAAGATTCTCGAGAATCTTGCGCACATCTCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092618    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013911.2-1695s1c1
Sequence:CCGGCCGTTCACACATTTAGGAATACTCGAGTATTCCTAAATGTGTGAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013911.2-1446s1c1
Sequence:CCGGGCATAGTTATTGTTAGGGCTTCTCGAGAAGCCCTAACAATAACTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013911.2-1196s1c1
Sequence:CCGGCTTCGAGATGTGCGCAAGATTCTCGAGAATCTTGCGCACATCTCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013911.2-919s1c1
Sequence:CCGGCGAAATCTCCATGATCTGGTTCTCGAGAACCAGATCATGGAGATTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013911.2-1440s1c1
Sequence:CCGGCCCACTGCATAGTTATTGTTACTCGAGTAACAATAACTATGCAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017703
VALIDATED
FBXL12 MISSION shRNA Bacterial Glycerol Stock
F-box and leucine-rich repeat protein 12
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000284384    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_017703.1-1658s21c1
Sequence:CCGGCACAAGCCTATACACCATTTACTCGAGTAAATGGTGTATAGGCTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017703.1-1167s21c1
Sequence:CCGGCACTGTATGGTCATCGTCAGGCTCGAGCCTGACGATGACCATACAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017703.1-846s21c1
Sequence:CCGGAGCTATCTGCAGAGGCTTGAGCTCGAGCTCAAGCCTCTGCAGATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017703.1-697s21c1
Sequence:CCGGTGCTTGAATGCATCGTGCTGGCTCGAGCCAGCACGATGCATTCAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_017703.1-920s1c1
Sequence:CCGGCCTCCGAGATGTGCGCAAGATCTCGAGATCTTGCGCACATCTCGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017703.1-393s1c1
Sequence:CCGGCTCTACACGATGCGACCTAAACTCGAGTTTAGGTCGCATCGTGTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017703.1-1202s1c1
Sequence:CCGGGTCTATGGACTGGTGGATGTACTCGAGTACATCCACCAGTCCATAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017703.1-1075s1c1
Sequence:CCGGGCCTCACTATGCCCAAGCTCACTCGAGTGAGCTTGGGCATAGTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017703.1-449s1c1
Sequence:CCGGCCGGCTCCATTCCCTGCGGATCTCGAGATCCGCAGGGAATGGAGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017703
VALIDATED
FBXL12 MISSION shRNA shRNA Plasmid DNA
F-box and leucine-rich repeat protein 12
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000284384    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_017703.1-1658s21c1
Sequence:CCGGCACAAGCCTATACACCATTTACTCGAGTAAATGGTGTATAGGCTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017703.1-1167s21c1
Sequence:CCGGCACTGTATGGTCATCGTCAGGCTCGAGCCTGACGATGACCATACAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017703.1-846s21c1
Sequence:CCGGAGCTATCTGCAGAGGCTTGAGCTCGAGCTCAAGCCTCTGCAGATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017703.1-697s21c1
Sequence:CCGGTGCTTGAATGCATCGTGCTGGCTCGAGCCAGCACGATGCATTCAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_017703.1-920s1c1
Sequence:CCGGCCTCCGAGATGTGCGCAAGATCTCGAGATCTTGCGCACATCTCGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017703.1-393s1c1
Sequence:CCGGCTCTACACGATGCGACCTAAACTCGAGTTTAGGTCGCATCGTGTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017703.1-1202s1c1
Sequence:CCGGGTCTATGGACTGGTGGATGTACTCGAGTACATCCACCAGTCCATAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017703.1-1075s1c1
Sequence:CCGGGCCTCACTATGCCCAAGCTCACTCGAGTGAGCTTGGGCATAGTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017703.1-449s1c1
Sequence:CCGGCCGGCTCCATTCCCTGCGGATCTCGAGATCCGCAGGGAATGGAGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017703
VALIDATED
FBXL12 MISSION shRNA Lentiviral Transduction Particles
F-box and leucine-rich repeat protein 12
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000284384    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_017703.1-1658s21c1
Sequence:CCGGCACAAGCCTATACACCATTTACTCGAGTAAATGGTGTATAGGCTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017703.1-1167s21c1
Sequence:CCGGCACTGTATGGTCATCGTCAGGCTCGAGCCTGACGATGACCATACAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017703.1-846s21c1
Sequence:CCGGAGCTATCTGCAGAGGCTTGAGCTCGAGCTCAAGCCTCTGCAGATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017703.1-697s21c1
Sequence:CCGGTGCTTGAATGCATCGTGCTGGCTCGAGCCAGCACGATGCATTCAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_017703.1-920s1c1
Sequence:CCGGCCTCCGAGATGTGCGCAAGATCTCGAGATCTTGCGCACATCTCGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017703.1-393s1c1
Sequence:CCGGCTCTACACGATGCGACCTAAACTCGAGTTTAGGTCGCATCGTGTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017703.1-1202s1c1
Sequence:CCGGGTCTATGGACTGGTGGATGTACTCGAGTACATCCACCAGTCCATAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017703.1-1075s1c1
Sequence:CCGGGCCTCACTATGCCCAAGCTCACTCGAGTGAGCTTGGGCATAGTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017703.1-449s1c1
Sequence:CCGGCCGGCTCCATTCCCTGCGGATCTCGAGATCCGCAGGGAATGGAGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks