EMAIL THIS PAGE TO A FRIEND

FBXL13

F-box and leucine-rich repeat protein 13

70 Gene Product Result for
Synonyms: Fbl13
Gene ID:
Human(222235) Summary: Members of the F-box protein family, such as FBXL13, are characterized by an approximately 40-amino acid F-box motif. SCF complexes, formed by SKP1 (MIM 601434), cullin (see CUL1; MIM 603134), and F-box proteins, act as protein-ubiquitin ligases. F-box proteins interact with SKP1 through the F box, and they interact with ubiquitination targets through other protein interaction domains (Jin et al., 2004 [PubMed 15520277]
Mouse(320118) F-box and leucine-rich repeat protein 13
Rat(100125363) F-box and leucine-rich repeat protein 13
domestic guinea pig(100724753) F-box and leucine-rich repeat protein 13
naked mole-rat(101726579) F-box and leucine-rich repeat protein 13
sheep(101118523) F-box and leucine-rich repeat protein 13
Domestic Rabbit(100352325) F-box and leucine-rich repeat protein 13
chicken(417721) F-box and leucine-rich repeat protein 13
domestic cat(101087390) F-box and leucine-rich repeat protein 13
cow(523598) F-box and leucine-rich repeat protein 13
cow(101905084) F-box and leucine-rich repeat protein 13
dog(609997) F-box and leucine-rich repeat protein 13
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145032 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145032 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145032 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177076 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177076 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177076 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU075671 MISSION® esiRNA esiRNA human FBXL13 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001111038 Rosetta Predictions human pricing
NM_145032 Rosetta Predictions human pricing
NM_001103355 Rosetta Predictions rat pricing
NM_177076 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001111038 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00325156 predicted 1694
2 SASI_Hs02_00325157 predicted 1283
3 SASI_Hs02_00325158 predicted 475
4 SASI_Hs02_00325159 predicted 478
5 SASI_Hs02_00325160 predicted 2257
6 SASI_Hs02_00325161 predicted 1293
7 SASI_Hs02_00325162 predicted 893
8 SASI_Hs02_00325163 predicted 1528
9 SASI_Hs02_00325164 predicted 903
10 SASI_Hs02_00325165 predicted 1717
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145032 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00154885 predicted 1870
2 SASI_Hs02_00364899 predicted 1455
3 SASI_Hs02_00364900 predicted 651
4 SASI_Hs01_00154886 predicted 655
5 SASI_Hs02_00364901 predicted 2563
6 SASI_Hs01_00154889 predicted 1469
7 SASI_Hs01_00154890 predicted 1063
8 SASI_Hs02_00364902 predicted 1707
9 SASI_Hs01_00154891 predicted 1082
10 SASI_Hs01_00154892 predicted 1894
11 SASI_Hs01_00154884 predicted 1673
12 SASI_Hs01_00154887 predicted 1323
13 SASI_Hs01_00154888 predicted 2403
14 SASI_Hs01_00154893 predicted 2052
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001103355 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00211544 predicted 1688
2 SASI_Rn02_00211545 predicted 373
3 SASI_Rn02_00211546 predicted 1811
4 SASI_Rn02_00211547 predicted 562
5 SASI_Rn02_00211548 predicted 1623
6 SASI_Rn02_00211549 predicted 1804
7 SASI_Rn02_00211550 predicted 448
8 SASI_Rn02_00211551 predicted 951
9 SASI_Rn02_00211552 predicted 667
10 SASI_Rn02_00211553 predicted 687
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177076 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00116094 predicted 281
2 SASI_Mm01_00116095 predicted 1608
3 SASI_Mm02_00347056 predicted 414
4 SASI_Mm01_00116096 predicted 1742
5 SASI_Mm01_00116097 predicted 1730
6 SASI_Mm01_00116100 predicted 1543
7 SASI_Mm01_00116101 predicted 1093
8 SASI_Mm01_00116102 predicted 979
9 SASI_Mm01_00116103 predicted 2039
10 SASI_Mm02_00347057 predicted 1654
11 SASI_Mm01_00116098 predicted 605
12 SASI_Mm01_00116099 predicted 1204
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145032
FBXL13 MISSION shRNA Bacterial Glycerol Stock
F-box and leucine-rich repeat protein 13
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000118582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145032.2-656s1c1
Sequence:CCGGCGGATACAACAGATCATCTATCTCGAGATAGATGATCTGTTGTATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145032.2-1349s1c1
Sequence:CCGGCGGTTCACAGACAAAGGCTTACTCGAGTAAGCCTTTGTCTGTGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145032.2-2479s1c1
Sequence:CCGGGCAGCAGGAATACAACACTAACTCGAGTTAGTGTTGTATTCCTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145032.2-2480s1c1
Sequence:CCGGCAGCAGGAATACAACACTAATCTCGAGATTAGTGTTGTATTCCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145032.2-655s1c1
Sequence:CCGGGCGGATACAACAGATCATCTACTCGAGTAGATGATCTGTTGTATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145032.2-656s1c2
Sequence:CCGGCGGATACAACAGATCATCTATCTCGAGATAGATGATCTGTTGTATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145032.2-1084s1c1
Sequence:CCGGGCGTTTAAATGTGCTGCGTTTCTCGAGAAACGCAGCACATTTAAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128047    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145032.2-1191s1c1
Sequence:CCGGGCCCAACATTCACAGATGAATCTCGAGATTCATCTGTGAATGTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145032.2-2160s1c1
Sequence:CCGGGCTCACTGATCTTGGAACATTCTCGAGAATGTTCCAAGATCAGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145032.2-2479s1c2
Sequence:CCGGGCAGCAGGAATACAACACTAACTCGAGTTAGTGTTGTATTCCTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128046    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145032.2-1168s1c1
Sequence:CCGGGCAAGAGTTGAATGTCTCTGACTCGAGTCAGAGACATTCAACTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145032.2-1554s1c1
Sequence:CCGGCTCGTATTACATCGCTGGTTTCTCGAGAAACCAGCGATGTAATACGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145032
FBXL13 MISSION shRNA shRNA Plasmid DNA
F-box and leucine-rich repeat protein 13
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000118582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145032.2-656s1c1
Sequence:CCGGCGGATACAACAGATCATCTATCTCGAGATAGATGATCTGTTGTATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145032.2-1349s1c1
Sequence:CCGGCGGTTCACAGACAAAGGCTTACTCGAGTAAGCCTTTGTCTGTGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145032.2-2479s1c1
Sequence:CCGGGCAGCAGGAATACAACACTAACTCGAGTTAGTGTTGTATTCCTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145032.2-2480s1c1
Sequence:CCGGCAGCAGGAATACAACACTAATCTCGAGATTAGTGTTGTATTCCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145032.2-655s1c1
Sequence:CCGGGCGGATACAACAGATCATCTACTCGAGTAGATGATCTGTTGTATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145032.2-656s1c2
Sequence:CCGGCGGATACAACAGATCATCTATCTCGAGATAGATGATCTGTTGTATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145032.2-1084s1c1
Sequence:CCGGGCGTTTAAATGTGCTGCGTTTCTCGAGAAACGCAGCACATTTAAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128047    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145032.2-1191s1c1
Sequence:CCGGGCCCAACATTCACAGATGAATCTCGAGATTCATCTGTGAATGTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145032.2-2160s1c1
Sequence:CCGGGCTCACTGATCTTGGAACATTCTCGAGAATGTTCCAAGATCAGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145032.2-2479s1c2
Sequence:CCGGGCAGCAGGAATACAACACTAACTCGAGTTAGTGTTGTATTCCTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128046    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145032.2-1168s1c1
Sequence:CCGGGCAAGAGTTGAATGTCTCTGACTCGAGTCAGAGACATTCAACTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145032.2-1554s1c1
Sequence:CCGGCTCGTATTACATCGCTGGTTTCTCGAGAAACCAGCGATGTAATACGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145032
FBXL13 MISSION shRNA Lentiviral Transduction Particles
F-box and leucine-rich repeat protein 13
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000118582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145032.2-656s1c1
Sequence:CCGGCGGATACAACAGATCATCTATCTCGAGATAGATGATCTGTTGTATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145032.2-1349s1c1
Sequence:CCGGCGGTTCACAGACAAAGGCTTACTCGAGTAAGCCTTTGTCTGTGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145032.2-2479s1c1
Sequence:CCGGGCAGCAGGAATACAACACTAACTCGAGTTAGTGTTGTATTCCTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145032.2-2480s1c1
Sequence:CCGGCAGCAGGAATACAACACTAATCTCGAGATTAGTGTTGTATTCCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145032.2-655s1c1
Sequence:CCGGGCGGATACAACAGATCATCTACTCGAGTAGATGATCTGTTGTATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145032.2-656s1c2
Sequence:CCGGCGGATACAACAGATCATCTATCTCGAGATAGATGATCTGTTGTATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145032.2-1084s1c1
Sequence:CCGGGCGTTTAAATGTGCTGCGTTTCTCGAGAAACGCAGCACATTTAAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128047    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145032.2-1191s1c1
Sequence:CCGGGCCCAACATTCACAGATGAATCTCGAGATTCATCTGTGAATGTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145032.2-2160s1c1
Sequence:CCGGGCTCACTGATCTTGGAACATTCTCGAGAATGTTCCAAGATCAGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145032.2-2479s1c2
Sequence:CCGGGCAGCAGGAATACAACACTAACTCGAGTTAGTGTTGTATTCCTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128046    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145032.2-1168s1c1
Sequence:CCGGGCAAGAGTTGAATGTCTCTGACTCGAGTCAGAGACATTCAACTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145032.2-1554s1c1
Sequence:CCGGCTCGTATTACATCGCTGGTTTCTCGAGAAACCAGCGATGTAATACGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177076
FBXL13 MISSION shRNA Bacterial Glycerol Stock
F-box and leucine-rich repeat protein 13
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000092148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177076.2-1803s1c1
Sequence:CCGGGCAAGCATGTTATCCTTGATACTCGAGTATCAAGGATAACATGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177076.2-1087s1c1
Sequence:CCGGGCCAGTCTTTCACAGATGAATCTCGAGATTCATCTGTGAAAGACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177076.2-1736s1c1
Sequence:CCGGCCCTAATTTACACTACTTGAACTCGAGTTCAAGTAGTGTAAATTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177076.2-981s1c1
Sequence:CCGGCGGCTAAACGTGCTGCGTTTACTCGAGTAAACGCAGCACGTTTAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177076.2-576s1c1
Sequence:CCGGCGGTTGCGACATTTGTTCTATCTCGAGATAGAACAAATGTCGCAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000441320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177076.4-711s21c1
Sequence:CCGGCAAGTTAGGGAAGCCGATTAGCTCGAGCTAATCGGCTTCCCTAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000440539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177076.4-770s21c1
Sequence:CCGGGGCGCATAGCATTTGACATTTCTCGAGAAATGTCAAATGCTATGCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177076
FBXL13 MISSION shRNA shRNA Plasmid DNA
F-box and leucine-rich repeat protein 13
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000092148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177076.2-1803s1c1
Sequence:CCGGGCAAGCATGTTATCCTTGATACTCGAGTATCAAGGATAACATGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177076.2-1087s1c1
Sequence:CCGGGCCAGTCTTTCACAGATGAATCTCGAGATTCATCTGTGAAAGACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177076.2-1736s1c1
Sequence:CCGGCCCTAATTTACACTACTTGAACTCGAGTTCAAGTAGTGTAAATTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177076.2-981s1c1
Sequence:CCGGCGGCTAAACGTGCTGCGTTTACTCGAGTAAACGCAGCACGTTTAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177076.2-576s1c1
Sequence:CCGGCGGTTGCGACATTTGTTCTATCTCGAGATAGAACAAATGTCGCAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000441320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177076.4-711s21c1
Sequence:CCGGCAAGTTAGGGAAGCCGATTAGCTCGAGCTAATCGGCTTCCCTAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000440539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177076.4-770s21c1
Sequence:CCGGGGCGCATAGCATTTGACATTTCTCGAGAAATGTCAAATGCTATGCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177076
FBXL13 MISSION shRNA Lentiviral Transduction Particles
F-box and leucine-rich repeat protein 13
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000092148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177076.2-1803s1c1
Sequence:CCGGGCAAGCATGTTATCCTTGATACTCGAGTATCAAGGATAACATGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177076.2-1087s1c1
Sequence:CCGGGCCAGTCTTTCACAGATGAATCTCGAGATTCATCTGTGAAAGACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177076.2-1736s1c1
Sequence:CCGGCCCTAATTTACACTACTTGAACTCGAGTTCAAGTAGTGTAAATTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177076.2-981s1c1
Sequence:CCGGCGGCTAAACGTGCTGCGTTTACTCGAGTAAACGCAGCACGTTTAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177076.2-576s1c1
Sequence:CCGGCGGTTGCGACATTTGTTCTATCTCGAGATAGAACAAATGTCGCAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000441320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177076.4-711s21c1
Sequence:CCGGCAAGTTAGGGAAGCCGATTAGCTCGAGCTAATCGGCTTCCCTAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000440539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177076.4-770s21c1
Sequence:CCGGGGCGCATAGCATTTGACATTTCTCGAGAAATGTCAAATGCTATGCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks