EMAIL THIS PAGE TO A FRIEND

FBXL14

F-box and leucine-rich repeat protein 14

50 Gene Product Result for
Synonyms: Fbl14
UniProtKB ID: Q8N1E6
Gene ID:
Human(144699) Summary: Members of the F-box protein family, such as FBXL14, are characterized by an approximately 40-amino acid F-box motif. SCF complexes, formed by SKP1 (MIM 601434), cullin (see CUL1; MIM 603134), and F-box proteins, act as protein-ubiquitin ligases. F-box proteins interact with SKP1 through the F box, and they interact with ubiquitination targets through other protein interaction domains (Jin et al., 2004 [PubMed 15520277]
Mouse(101358) F-box and leucine-rich repeat protein 14
Rat(312675) F-box and leucine-rich repeat protein 14
chicken(427926) F-box and leucine-rich repeat protein 14
cow(531211) F-box and leucine-rich repeat protein 14
domestic cat(101086068) F-box and leucine-rich repeat protein 14
dog(486755) F-box and leucine-rich repeat protein 14
naked mole-rat(101697035) F-box and leucine-rich repeat protein 14
domestic guinea pig(100720585) F-box and leucine-rich repeat protein 14
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152441 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152441 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152441 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133940 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133940 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133940 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152441 Rosetta Predictions human pricing
XM_232330 Rosetta Predictions rat pricing
NM_133940 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152441 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00130332 predicted 967
2 SASI_Hs01_00130333 predicted 961
3 SASI_Hs01_00130334 predicted 1027
4 SASI_Hs01_00130335 predicted 778
5 SASI_Hs02_00366191 predicted 742
6 SASI_Hs01_00130336 predicted 499
7 SASI_Hs01_00130338 predicted 889
8 SASI_Hs02_00366192 predicted 344
9 SASI_Hs01_00130339 predicted 406
10 SASI_Hs01_00130340 predicted 978
11 SASI_Hs01_00130331 predicted 746
12 SASI_Hs01_00130337 predicted 567
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_232330 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00387081 predicted 820
2 SASI_Rn02_00387082 predicted 1831
3 SASI_Rn02_00387083 predicted 1708
4 SASI_Rn02_00387084 predicted 1809
5 SASI_Rn02_00387085 predicted 1839
6 SASI_Rn02_00387086 predicted 1816
7 SASI_Rn02_00387087 predicted 1818
8 SASI_Rn02_00387088 predicted 1762
9 SASI_Rn02_00387089 predicted 1842
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133940 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00098550 predicted 709
2 SASI_Mm01_00098551 predicted 912
3 SASI_Mm01_00098552 predicted 1542
4 SASI_Mm02_00339039 predicted 726
5 SASI_Mm02_00339040 predicted 722
6 SASI_Mm01_00098557 predicted 717
7 SASI_Mm02_00339041 predicted 1484
8 SASI_Mm01_00098559 predicted 1351
9 SASI_Mm02_00339042 predicted 702
10 SASI_Mm02_00339043 predicted 1490
11 SASI_Mm01_00098553 predicted 447
12 SASI_Mm01_00098554 predicted 965
13 SASI_Mm01_00098555 predicted 596
14 SASI_Mm01_00098556 predicted 1247
15 SASI_Mm01_00098558 predicted 490
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152441
FBXL14 MISSION shRNA Bacterial Glycerol Stock
F-box and leucine-rich repeat protein 14
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152441.1-735s21c1
Sequence:CCGGCCAGAAGCTCACAGATCTTTCCTCGAGGAAAGATCTGTGAGCTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245551    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152441.1-1374s21c1
Sequence:CCGGCATGGTTCCCGTGGATCTTTACTCGAGTAAAGATCCACGGGAACCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152441.1-980s21c1
Sequence:CCGGACCAGAGTCTGGCTTACATAGCTCGAGCTATGTAAGCCAGACTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152441.1-878s21c1
Sequence:CCGGTGCGCTCCTGTGACAACATCACTCGAGTGATGTTGTCACAGGAGCGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152441.1-396s21c1
Sequence:CCGGCTGCTACAACCTCACCGACAACTCGAGTTGTCGGTGAGGTTGTAGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180800    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152441.1-734s1c1
Sequence:CCGGGCCAGAAGCTCACAGATCTTTCTCGAGAAAGATCTGTGAGCTTCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146746    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152441.1-1313s1c1
Sequence:CCGGCTCCATTATTCACTGTGAGAACTCGAGTTCTCACAGTGAATAATGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152441
FBXL14 MISSION shRNA shRNA Plasmid DNA
F-box and leucine-rich repeat protein 14
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152441.1-735s21c1
Sequence:CCGGCCAGAAGCTCACAGATCTTTCCTCGAGGAAAGATCTGTGAGCTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245551    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152441.1-1374s21c1
Sequence:CCGGCATGGTTCCCGTGGATCTTTACTCGAGTAAAGATCCACGGGAACCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152441.1-980s21c1
Sequence:CCGGACCAGAGTCTGGCTTACATAGCTCGAGCTATGTAAGCCAGACTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152441.1-878s21c1
Sequence:CCGGTGCGCTCCTGTGACAACATCACTCGAGTGATGTTGTCACAGGAGCGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152441.1-396s21c1
Sequence:CCGGCTGCTACAACCTCACCGACAACTCGAGTTGTCGGTGAGGTTGTAGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180800    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152441.1-734s1c1
Sequence:CCGGGCCAGAAGCTCACAGATCTTTCTCGAGAAAGATCTGTGAGCTTCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146746    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152441.1-1313s1c1
Sequence:CCGGCTCCATTATTCACTGTGAGAACTCGAGTTCTCACAGTGAATAATGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152441
FBXL14 MISSION shRNA Lentiviral Transduction Particles
F-box and leucine-rich repeat protein 14
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152441.1-735s21c1
Sequence:CCGGCCAGAAGCTCACAGATCTTTCCTCGAGGAAAGATCTGTGAGCTTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245551    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152441.1-1374s21c1
Sequence:CCGGCATGGTTCCCGTGGATCTTTACTCGAGTAAAGATCCACGGGAACCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152441.1-980s21c1
Sequence:CCGGACCAGAGTCTGGCTTACATAGCTCGAGCTATGTAAGCCAGACTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152441.1-878s21c1
Sequence:CCGGTGCGCTCCTGTGACAACATCACTCGAGTGATGTTGTCACAGGAGCGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152441.1-396s21c1
Sequence:CCGGCTGCTACAACCTCACCGACAACTCGAGTTGTCGGTGAGGTTGTAGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180800    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152441.1-734s1c1
Sequence:CCGGGCCAGAAGCTCACAGATCTTTCTCGAGAAAGATCTGTGAGCTTCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146746    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152441.1-1313s1c1
Sequence:CCGGCTCCATTATTCACTGTGAGAACTCGAGTTCTCACAGTGAATAATGGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133940
FBXL14 MISSION shRNA Bacterial Glycerol Stock
F-box and leucine-rich repeat protein 14
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000200380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133940.1-720s1c1
Sequence:CCGGGCCAGAAACTCACGGATCTTTCTCGAGAAAGATCCGTGAGTTTCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182658    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133940.1-1650s1c1
Sequence:CCGGGCCTGCCTTCACTTACACTTTCTCGAGAAAGTGTAAGTGAAGGCAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133940.1-130s1c1
Sequence:CCGGGATCTTCGGCTACTTGGACTTCTCGAGAAGTCCAAGTAGCCGAAGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177949    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133940.1-2226s1c1
Sequence:CCGGGCACAAATGTATGGGAGAAATCTCGAGATTTCTCCCATACATTTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133940
FBXL14 MISSION shRNA shRNA Plasmid DNA
F-box and leucine-rich repeat protein 14
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000200380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133940.1-720s1c1
Sequence:CCGGGCCAGAAACTCACGGATCTTTCTCGAGAAAGATCCGTGAGTTTCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182658    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133940.1-1650s1c1
Sequence:CCGGGCCTGCCTTCACTTACACTTTCTCGAGAAAGTGTAAGTGAAGGCAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133940.1-130s1c1
Sequence:CCGGGATCTTCGGCTACTTGGACTTCTCGAGAAGTCCAAGTAGCCGAAGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177949    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133940.1-2226s1c1
Sequence:CCGGGCACAAATGTATGGGAGAAATCTCGAGATTTCTCCCATACATTTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133940
FBXL14 MISSION shRNA Lentiviral Transduction Particles
F-box and leucine-rich repeat protein 14
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000200380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133940.1-720s1c1
Sequence:CCGGGCCAGAAACTCACGGATCTTTCTCGAGAAAGATCCGTGAGTTTCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182658    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133940.1-1650s1c1
Sequence:CCGGGCCTGCCTTCACTTACACTTTCTCGAGAAAGTGTAAGTGAAGGCAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133940.1-130s1c1
Sequence:CCGGGATCTTCGGCTACTTGGACTTCTCGAGAAGTCCAAGTAGCCGAAGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177949    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133940.1-2226s1c1
Sequence:CCGGGCACAAATGTATGGGAGAAATCTCGAGATTTCTCCCATACATTTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)