EMAIL THIS PAGE TO A FRIEND

FBXL15

F-box and leucine-rich repeat protein 15

81 Gene Product Result for
Synonyms: FBXO37 Fbl15 JET PSD
Gene ID:
Mouse(68431) F-box and leucine-rich repeat protein 15
Rat(309453) F-box and leucine-rich repeat protein 15
Zebrafish(405878) F-box and leucine-rich repeat protein 15
cow(519874) F-box and leucine-rich repeat protein 15
domestic cat(101081084) F-box and leucine-rich repeat protein 15
dog(486860) F-box and leucine-rich repeat protein 15
chicken(428951) F-box and leucine-rich repeat protein 15
domestic guinea pig(100713858) F-box and leucine-rich repeat protein 15
naked mole-rat(101715202) F-box and leucine-rich repeat protein 15
Goat(100861070) F-box and leucine-rich repeat protein 15
sheep(101114741) F-box and leucine-rich repeat protein 15
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301478 ANTI-FBXL15 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133694 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133694 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133694 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024326 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024326 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024326 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024326 Rosetta Predictions human pricing
NM_001107603 Rosetta Predictions rat pricing
NM_133694 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024326 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00160102 predicted 1942
2 SASI_Hs01_00160103 predicted 1995
3 SASI_Hs01_00160104 predicted 1932
4 SASI_Hs01_00160105 predicted 1997
5 SASI_Hs01_00160106 predicted 1505
6 SASI_Hs01_00160107 predicted 1585
7 SASI_Hs01_00160108 predicted 2073
8 SASI_Hs01_00160109 predicted 1963
9 SASI_Hs02_00356675 predicted 2207
10 SASI_Hs01_00160110 predicted 2295
11 SASI_Hs01_00160111 predicted 2200
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107603 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00230465 predicted 801
2 SASI_Rn02_00230466 predicted 931
3 SASI_Rn02_00230467 predicted 921
4 SASI_Rn02_00230468 predicted 719
5 SASI_Rn02_00230469 predicted 792
6 SASI_Rn02_00230470 predicted 462
7 SASI_Rn02_00230471 predicted 944
8 SASI_Rn02_00230472 predicted 470
9 SASI_Rn02_00230473 predicted 1008
10 SASI_Rn02_00230474 predicted 719
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133694 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00174631 predicted 991
2 SASI_Mm01_00174632 predicted 799
3 SASI_Mm01_00174633 predicted 919
4 SASI_Mm01_00174634 predicted 712
5 SASI_Mm01_00174635 predicted 915
6 SASI_Mm01_00174636 predicted 796
7 SASI_Mm01_00174637 predicted 712
8 SASI_Mm01_00174638 predicted 528
9 SASI_Mm01_00174639 predicted 813
10 SASI_Mm01_00174640 predicted 958
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133694
FBXL15 MISSION shRNA Bacterial Glycerol Stock
F-box and leucine-rich repeat protein 15
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000086938    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133694.1-1210s1c1
Sequence:CCGGCCGGGCTTGACCCTGAGCCATCTCGAGATGGCTCAGGGTCAAGCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133694.1-1145s1c1
Sequence:CCGGCCCTTTGTCAACCTACAGGTTCTCGAGAACCTGTAGGTTGACAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133694.1-853s1c1
Sequence:CCGGCAGCCTCTCATTAGCAGTCAACTCGAGTTGACTGCTAATGAGAGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133694.1-894s1c1
Sequence:CCGGCGGTTCAAGAGTTGGCTCGAACTCGAGTTCGAGCCAACTCTTGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133694.2-1160s21c1
Sequence:CCGGAGGCTTCGCACCCTTTGTCAACTCGAGTTGACAAAGGGTGCGAAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133694.2-493s21c1
Sequence:CCGGCTCAGGTGGGTCCACAGATTCCTCGAGGAATCTGTGGACCCACCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133694.2-921s21c1
Sequence:CCGGGTTCAAGAGTTGGCTCGAAACCTCGAGGTTTCGAGCCAACTCTTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133694.2-1136s21c1
Sequence:CCGGTCTGGTGCTACTCCAGGACATCTCGAGATGTCCTGGAGTAGCACCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133694.2-1182s21c1
Sequence:CCGGCTACAGGTCTGACTAACTTTCCTCGAGGAAAGTTAGTCAGACCTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133694.2-886s21c1
Sequence:CCGGCATTAGCAGTCAACGCCAATGCTCGAGCATTGGCGTTGACTGCTAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133694.2-809s21c1
Sequence:CCGGCACCGCCTGTCGTCAACTCAACTCGAGTTGAGTTGACGACAGGCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133694
FBXL15 MISSION shRNA shRNA Plasmid DNA
F-box and leucine-rich repeat protein 15
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000086938    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133694.1-1210s1c1
Sequence:CCGGCCGGGCTTGACCCTGAGCCATCTCGAGATGGCTCAGGGTCAAGCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133694.1-1145s1c1
Sequence:CCGGCCCTTTGTCAACCTACAGGTTCTCGAGAACCTGTAGGTTGACAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133694.1-853s1c1
Sequence:CCGGCAGCCTCTCATTAGCAGTCAACTCGAGTTGACTGCTAATGAGAGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133694.1-894s1c1
Sequence:CCGGCGGTTCAAGAGTTGGCTCGAACTCGAGTTCGAGCCAACTCTTGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133694.2-1160s21c1
Sequence:CCGGAGGCTTCGCACCCTTTGTCAACTCGAGTTGACAAAGGGTGCGAAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133694.2-493s21c1
Sequence:CCGGCTCAGGTGGGTCCACAGATTCCTCGAGGAATCTGTGGACCCACCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133694.2-921s21c1
Sequence:CCGGGTTCAAGAGTTGGCTCGAAACCTCGAGGTTTCGAGCCAACTCTTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133694.2-1136s21c1
Sequence:CCGGTCTGGTGCTACTCCAGGACATCTCGAGATGTCCTGGAGTAGCACCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133694.2-1182s21c1
Sequence:CCGGCTACAGGTCTGACTAACTTTCCTCGAGGAAAGTTAGTCAGACCTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133694.2-886s21c1
Sequence:CCGGCATTAGCAGTCAACGCCAATGCTCGAGCATTGGCGTTGACTGCTAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133694.2-809s21c1
Sequence:CCGGCACCGCCTGTCGTCAACTCAACTCGAGTTGAGTTGACGACAGGCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133694
FBXL15 MISSION shRNA Lentiviral Transduction Particles
F-box and leucine-rich repeat protein 15
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000086938    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133694.1-1210s1c1
Sequence:CCGGCCGGGCTTGACCCTGAGCCATCTCGAGATGGCTCAGGGTCAAGCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133694.1-1145s1c1
Sequence:CCGGCCCTTTGTCAACCTACAGGTTCTCGAGAACCTGTAGGTTGACAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133694.1-853s1c1
Sequence:CCGGCAGCCTCTCATTAGCAGTCAACTCGAGTTGACTGCTAATGAGAGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133694.1-894s1c1
Sequence:CCGGCGGTTCAAGAGTTGGCTCGAACTCGAGTTCGAGCCAACTCTTGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133694.2-1160s21c1
Sequence:CCGGAGGCTTCGCACCCTTTGTCAACTCGAGTTGACAAAGGGTGCGAAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133694.2-493s21c1
Sequence:CCGGCTCAGGTGGGTCCACAGATTCCTCGAGGAATCTGTGGACCCACCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133694.2-921s21c1
Sequence:CCGGGTTCAAGAGTTGGCTCGAAACCTCGAGGTTTCGAGCCAACTCTTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133694.2-1136s21c1
Sequence:CCGGTCTGGTGCTACTCCAGGACATCTCGAGATGTCCTGGAGTAGCACCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133694.2-1182s21c1
Sequence:CCGGCTACAGGTCTGACTAACTTTCCTCGAGGAAAGTTAGTCAGACCTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133694.2-886s21c1
Sequence:CCGGCATTAGCAGTCAACGCCAATGCTCGAGCATTGGCGTTGACTGCTAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133694.2-809s21c1
Sequence:CCGGCACCGCCTGTCGTCAACTCAACTCGAGTTGAGTTGACGACAGGCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024326
FBXL15 MISSION shRNA Bacterial Glycerol Stock
F-box and leucine-rich repeat protein 15
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000118557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024326.2-2006s1c1
Sequence:CCGGTGTCAGGACATTGGCCGAGTACTCGAGTACTCGGCCAATGTCCTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024326.2-1584s1c1
Sequence:CCGGCCGTGTCACGAATGGCTGTCACTCGAGTGACAGCCATTCGTGACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024326.2-1927s1c1
Sequence:CCGGCGGTTCAAGAGTTGGCTCGGACTCGAGTCCGAGCCAACTCTTGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024326.2-1829s1c1
Sequence:CCGGCCAGCTCAAGGACGAGGCCATCTCGAGATGGCCTCGTCCTTGAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024326.2-2142s1c1
Sequence:CCGGGCCCTGGTGCTGCTGCAGGATCTCGAGATCCTGCAGCAGCACCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024326.3-1973s21c1
Sequence:CCGGAGAACTCCACCACCTTGACCTCTCGAGAGGTCAAGGTGGTGGAGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024326.3-2200s21c1
Sequence:CCGGTTGTCAACCTGCAGGTCTGACCTCGAGGTCAGACCTGCAGGTTGACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024326.3-2016s21c1
Sequence:CCGGAGCGACGGTGTCAGGACATTGCTCGAGCAATGTCCTGACACCGTCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024326
FBXL15 MISSION shRNA shRNA Plasmid DNA
F-box and leucine-rich repeat protein 15
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000118557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024326.2-2006s1c1
Sequence:CCGGTGTCAGGACATTGGCCGAGTACTCGAGTACTCGGCCAATGTCCTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024326.2-1584s1c1
Sequence:CCGGCCGTGTCACGAATGGCTGTCACTCGAGTGACAGCCATTCGTGACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024326.2-1927s1c1
Sequence:CCGGCGGTTCAAGAGTTGGCTCGGACTCGAGTCCGAGCCAACTCTTGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024326.2-1829s1c1
Sequence:CCGGCCAGCTCAAGGACGAGGCCATCTCGAGATGGCCTCGTCCTTGAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024326.2-2142s1c1
Sequence:CCGGGCCCTGGTGCTGCTGCAGGATCTCGAGATCCTGCAGCAGCACCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024326.3-1973s21c1
Sequence:CCGGAGAACTCCACCACCTTGACCTCTCGAGAGGTCAAGGTGGTGGAGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024326.3-2200s21c1
Sequence:CCGGTTGTCAACCTGCAGGTCTGACCTCGAGGTCAGACCTGCAGGTTGACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024326.3-2016s21c1
Sequence:CCGGAGCGACGGTGTCAGGACATTGCTCGAGCAATGTCCTGACACCGTCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024326
FBXL15 MISSION shRNA Lentiviral Transduction Particles
F-box and leucine-rich repeat protein 15
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000118557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024326.2-2006s1c1
Sequence:CCGGTGTCAGGACATTGGCCGAGTACTCGAGTACTCGGCCAATGTCCTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024326.2-1584s1c1
Sequence:CCGGCCGTGTCACGAATGGCTGTCACTCGAGTGACAGCCATTCGTGACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024326.2-1927s1c1
Sequence:CCGGCGGTTCAAGAGTTGGCTCGGACTCGAGTCCGAGCCAACTCTTGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024326.2-1829s1c1
Sequence:CCGGCCAGCTCAAGGACGAGGCCATCTCGAGATGGCCTCGTCCTTGAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024326.2-2142s1c1
Sequence:CCGGGCCCTGGTGCTGCTGCAGGATCTCGAGATCCTGCAGCAGCACCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024326.3-1973s21c1
Sequence:CCGGAGAACTCCACCACCTTGACCTCTCGAGAGGTCAAGGTGGTGGAGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024326.3-2200s21c1
Sequence:CCGGTTGTCAACCTGCAGGTCTGACCTCGAGGTCAGACCTGCAGGTTGACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024326.3-2016s21c1
Sequence:CCGGAGCGACGGTGTCAGGACATTGCTCGAGCAATGTCCTGACACCGTCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks