EMAIL THIS PAGE TO A FRIEND

FBXL17

F-box and leucine-rich repeat protein 17

167 Gene Product Result for
Synonyms: FBXO13 Fbl17 Fbx13
UniProtKB ID: Q9UF56, A1A4E3
Gene ID:
Human(64839) Summary: Members of the F-box protein family, such as FBXL17, are characterized by an approximately 40-amino acid F-box motif. SCF complexes, formed by SKP1 (MIM 601434), cullin (see CUL1; MIM 603134), and F-box proteins, act as protein-ubiquitin ligases. F-box proteins interact with SKP1 through the F box, and they interact with ubiquitination targets through other protein interaction domains (Jin et al., 2004 [PubMed 15520277]
Mouse(50758) F-box and leucine-rich repeat protein 17
Rat(316663) F-box and leucine-rich repeat protein 17
chicken(415615) F-box and leucine-rich repeat protein 17
cow(782335) F-box and leucine-rich repeat protein 17
domestic cat(101093990) F-box and leucine-rich repeat protein 17
Horse(100146140) F-box and leucine-rich repeat protein 17
dog(608166) F-box and leucine-rich repeat protein 17
naked mole-rat(101725487) F-box and leucine-rich repeat protein 17
sheep(101106771) F-box and leucine-rich repeat protein 17
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_128716 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_128716 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_128716 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_022824 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022824 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022824 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022824 Rosetta Predictions human pricing
NM_001108235 Rosetta Predictions rat pricing
XM_001478436 Rosetta Predictions mouse pricing
XM_925135 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022824 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00105772 predicted 1429
2 SASI_Hs02_00356125 predicted 864
3 SASI_Hs01_00105773 predicted 1230
4 SASI_Hs01_00105774 predicted 1382
5 SASI_Hs01_00105775 predicted 1400
6 SASI_Hs01_00105776 predicted 1382
7 SASI_Hs01_00105777 predicted 1188
8 SASI_Hs01_00105778 predicted 980
9 SASI_Hs01_00105779 predicted 989
10 SASI_Hs01_00105781 predicted 1375
11 SASI_Hs01_00105780 predicted 1102
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108235 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00236654 predicted 674
2 SASI_Rn02_00236655 predicted 1108
3 SASI_Rn02_00236656 predicted 908
4 SASI_Rn02_00236657 predicted 859
5 SASI_Rn02_00236658 predicted 979
6 SASI_Rn02_00236659 predicted 1222
7 SASI_Rn02_00236660 predicted 738
8 SASI_Rn02_00236661 predicted 582
9 SASI_Rn02_00236662 predicted 1129
10 SASI_Rn02_00236663 predicted 660
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001478436 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00402628 predicted 913
2 SASI_Mm02_00402629 predicted 1219
3 SASI_Mm02_00402630 predicted 942
4 SASI_Mm02_00402631 predicted 250
5 SASI_Mm02_00402632 predicted 701
6 SASI_Mm02_00402633 predicted 537
7 SASI_Mm02_00402634 predicted 632
8 SASI_Mm02_00402635 predicted 1199
9 SASI_Mm02_00402636 predicted 585
10 SASI_Mm02_00402637 predicted 216
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_925135 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00444467 predicted 2040
2 SASI_Mm02_00444468 predicted 2226
3 SASI_Mm01_00265044 predicted 2114
4 SASI_Mm02_00444469 predicted 2020
5 SASI_Mm02_00444470 predicted 2881
6 SASI_Mm01_00265045 predicted 2407
7 SASI_Mm01_00265046 predicted 2141
8 SASI_Mm02_00444471 predicted 2393
9 SASI_Mm01_00265053 predicted 2095
10 SASI_Mm02_00444472 predicted 2894
11 SASI_Mm01_00265047 predicted 1499
12 SASI_Mm01_00265048 predicted 1950
13 SASI_Mm01_00265049 predicted 1789
14 SASI_Mm01_00265050 predicted 1885
15 SASI_Mm01_00265051 predicted 2450
16 SASI_Mm01_00265052 predicted 1470
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_128716
FBXL17 MISSION shRNA Bacterial Glycerol Stock
F-box and leucine-rich repeat protein 17
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000092533    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_128716.4-666s1c1
Sequence:CCGGGCATAGCATAAGCGCACTGTTCTCGAGAACAGTGCGCTTATGCTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128716.4-282s1c1
Sequence:CCGGCGTCGGATGGTGTAAAGAAATCTCGAGATTTCTTTACACCATCCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128716.4-36s1c1
Sequence:CCGGTCACCAGATGATGAACGAGAACTCGAGTTCTCGTTCATCATCTGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128716.4-367s1c1
Sequence:CCGGAGATGTGACAAAGTCAATGAACTCGAGTTCATTGACTTTGTCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128716.4-102s1c1
Sequence:CCGGGATGTCTGCAAGTTGTCCTTTCTCGAGAAAGGACAACTTGCAGACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_128716
FBXL17 MISSION shRNA shRNA Plasmid DNA
F-box and leucine-rich repeat protein 17
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000092533    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_128716.4-666s1c1
Sequence:CCGGGCATAGCATAAGCGCACTGTTCTCGAGAACAGTGCGCTTATGCTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128716.4-282s1c1
Sequence:CCGGCGTCGGATGGTGTAAAGAAATCTCGAGATTTCTTTACACCATCCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128716.4-36s1c1
Sequence:CCGGTCACCAGATGATGAACGAGAACTCGAGTTCTCGTTCATCATCTGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128716.4-367s1c1
Sequence:CCGGAGATGTGACAAAGTCAATGAACTCGAGTTCATTGACTTTGTCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128716.4-102s1c1
Sequence:CCGGGATGTCTGCAAGTTGTCCTTTCTCGAGAAAGGACAACTTGCAGACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_128716
FBXL17 MISSION shRNA Lentiviral Transduction Particles
F-box and leucine-rich repeat protein 17
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000092533    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_128716.4-666s1c1
Sequence:CCGGGCATAGCATAAGCGCACTGTTCTCGAGAACAGTGCGCTTATGCTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128716.4-282s1c1
Sequence:CCGGCGTCGGATGGTGTAAAGAAATCTCGAGATTTCTTTACACCATCCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128716.4-36s1c1
Sequence:CCGGTCACCAGATGATGAACGAGAACTCGAGTTCTCGTTCATCATCTGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128716.4-367s1c1
Sequence:CCGGAGATGTGACAAAGTCAATGAACTCGAGTTCATTGACTTTGTCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128716.4-102s1c1
Sequence:CCGGGATGTCTGCAAGTTGTCCTTTCTCGAGAAAGGACAACTTGCAGACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022824
FBXL17 MISSION shRNA Bacterial Glycerol Stock
F-box and leucine-rich repeat protein 17
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000118270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022824.1-1238s1c1
Sequence:CCGGGTCATATCACTGAACTGGATACTCGAGTATCCAGTTCAGTGATATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022824.1-1072s1c1
Sequence:CCGGCAAAGGATATACATGCAGGAACTCGAGTTCCTGCATGTATATCCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118267    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022824.1-3385s1c1
Sequence:CCGGGCCATGAGTATTCTTCCCATACTCGAGTATGGGAAGAATACTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022824.1-895s1c1
Sequence:CCGGGCCTCTCACTGTCCTTTACTTCTCGAGAAGTAAAGGACAGTGAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022824.1-1383s1c1
Sequence:CCGGGCTATATTTGGTGTCCTGTAACTCGAGTTACAGGACACCAAATATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022824
FBXL17 MISSION shRNA shRNA Plasmid DNA
F-box and leucine-rich repeat protein 17
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000118270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022824.1-1238s1c1
Sequence:CCGGGTCATATCACTGAACTGGATACTCGAGTATCCAGTTCAGTGATATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022824.1-1072s1c1
Sequence:CCGGCAAAGGATATACATGCAGGAACTCGAGTTCCTGCATGTATATCCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118267    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022824.1-3385s1c1
Sequence:CCGGGCCATGAGTATTCTTCCCATACTCGAGTATGGGAAGAATACTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022824.1-895s1c1
Sequence:CCGGGCCTCTCACTGTCCTTTACTTCTCGAGAAGTAAAGGACAGTGAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022824.1-1383s1c1
Sequence:CCGGGCTATATTTGGTGTCCTGTAACTCGAGTTACAGGACACCAAATATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022824
FBXL17 MISSION shRNA Lentiviral Transduction Particles
F-box and leucine-rich repeat protein 17
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000118270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022824.1-1238s1c1
Sequence:CCGGGTCATATCACTGAACTGGATACTCGAGTATCCAGTTCAGTGATATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022824.1-1072s1c1
Sequence:CCGGCAAAGGATATACATGCAGGAACTCGAGTTCCTGCATGTATATCCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118267    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022824.1-3385s1c1
Sequence:CCGGGCCATGAGTATTCTTCCCATACTCGAGTATGGGAAGAATACTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022824.1-895s1c1
Sequence:CCGGGCCTCTCACTGTCCTTTACTTCTCGAGAAGTAAAGGACAGTGAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022824.1-1383s1c1
Sequence:CCGGGCTATATTTGGTGTCCTGTAACTCGAGTTACAGGACACCAAATATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks