EMAIL THIS PAGE TO A FRIEND

FBXL18

F-box and leucine-rich repeat protein 18

48 Gene Product Result for
Synonyms: Fbl18
UniProtKB ID: Q96ME1, Q9BR90, Q9BTC7, Q9HAK7
Gene ID:
Human(80028) Summary: Members of the F-box protein family, such as FBXL18, are characterized by an approximately 40-amino acid F-box motif. SCF complexes, formed by SKP1 (MIM 601434), cullin (see CUL1; MIM 603134), and F-box proteins, act as protein-ubiquitin ligases. F-box proteins interact with SKP1 through the F box, and they interact with ubiquitination targets through other protein interaction domains (Jin et al., 2004 [PubMed 15520277]
Mouse(231863) F-box and leucine-rich repeat protein 18
Rat(678726) F-box and leucine-rich repeat protein 18
sheep(101108448) F-box and leucine-rich repeat protein 18
Domestic Rabbit(100341656) F-box and leucine-rich repeat protein 18
naked mole-rat(101718057) F-box and leucine-rich repeat protein 18
domestic guinea pig(100728425) F-box and leucine-rich repeat protein 18
Zebrafish(570298) F-box and leucine-rich repeat protein 18
cow(789838) F-box and leucine-rich repeat protein 18
Horse(100060973) F-box and leucine-rich repeat protein 18
domestic cat(101098272) F-box and leucine-rich repeat protein 18
dog(489881) F-box and leucine-rich repeat protein 18
chicken(416484) F-box and leucine-rich repeat protein 18
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001033312 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033312 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033312 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024963 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024963 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024963 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU099071 MISSION® esiRNA esiRNA human FBXL18 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024963 Rosetta Predictions human pricing
XM_001053150 Rosetta Predictions rat pricing
NM_001033312 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024963 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00357625 predicted 2712
2 SASI_Hs01_00010902 predicted 1061
3 SASI_Hs02_00357626 predicted 2111
4 SASI_Hs01_00010903 predicted 1079
5 SASI_Hs02_00357627 predicted 2196
6 SASI_Hs01_00010904 predicted 775
7 SASI_Hs02_00357628 predicted 2530
8 SASI_Hs02_00357629 predicted 2267
9 SASI_Hs01_00010905 predicted 862
10 SASI_Hs01_00010906 predicted 1031
11 SASI_Hs01_00010901 predicted 209
12 SASI_Hs01_00010907 predicted 748
13 SASI_Hs01_00010908 predicted 720
14 SASI_Hs01_00010909 predicted 1892
15 SASI_Hs01_00010910 predicted 569
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001053150 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00271433 predicted 869
2 SASI_Rn02_00271434 predicted 2727
3 SASI_Rn02_00271435 predicted 2732
4 SASI_Rn02_00271436 predicted 809
5 SASI_Rn02_00271437 predicted 835
6 SASI_Rn02_00271438 predicted 1079
7 SASI_Rn02_00271439 predicted 386
8 SASI_Rn02_00271440 predicted 1047
9 SASI_Rn02_00271441 predicted 744
10 SASI_Rn02_00271442 predicted 449
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033312 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00061148 predicted 2459
2 SASI_Mm01_00061149 predicted 2116
3 SASI_Mm01_00061150 predicted 2446
4 SASI_Mm01_00061151 predicted 2031
5 SASI_Mm01_00061152 predicted 1563
6 SASI_Mm01_00061153 predicted 1089
7 SASI_Mm01_00061155 predicted 1512
8 SASI_Mm01_00061156 predicted 834
9 SASI_Mm01_00061157 predicted 392
10 SASI_Mm02_00288517 predicted 1018
11 SASI_Mm01_00061154 predicted 2349
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033312
FBXL18 MISSION shRNA Bacterial Glycerol Stock
F-box and leucine-rich repeat protein 18
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201342    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001033312.1-2434s1c1
Sequence:CCGGGAGTACAGTGACAAGAAGTAACTCGAGTTACTTCTTGTCACTGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033312.1-328s1c1
Sequence:CCGGGAAGGTGAAGCAACTGGTGAACTCGAGTTCACCAGTTGCTTCACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033312.1-2016s1c1
Sequence:CCGGGTCACATGTTCACCGGAGAATCTCGAGATTCTCCGGTGAACATGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033312.1-175s1c1
Sequence:CCGGCGATGAGATCCTCCTACACATCTCGAGATGTGTAGGAGGATCTCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190757    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001033312.1-2413s1c1
Sequence:CCGGGATTCTCTCTGTCACTCTCATCTCGAGATGAGAGTGACAGAGAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033312.1-1012s1c1
Sequence:CCGGGAAATTCAACAATCCCTTCTACTCGAGTAGAAGGGATTGTTGAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033312
FBXL18 MISSION shRNA shRNA Plasmid DNA
F-box and leucine-rich repeat protein 18
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201342    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001033312.1-2434s1c1
Sequence:CCGGGAGTACAGTGACAAGAAGTAACTCGAGTTACTTCTTGTCACTGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033312.1-328s1c1
Sequence:CCGGGAAGGTGAAGCAACTGGTGAACTCGAGTTCACCAGTTGCTTCACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033312.1-2016s1c1
Sequence:CCGGGTCACATGTTCACCGGAGAATCTCGAGATTCTCCGGTGAACATGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033312.1-175s1c1
Sequence:CCGGCGATGAGATCCTCCTACACATCTCGAGATGTGTAGGAGGATCTCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190757    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001033312.1-2413s1c1
Sequence:CCGGGATTCTCTCTGTCACTCTCATCTCGAGATGAGAGTGACAGAGAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033312.1-1012s1c1
Sequence:CCGGGAAATTCAACAATCCCTTCTACTCGAGTAGAAGGGATTGTTGAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033312
FBXL18 MISSION shRNA Lentiviral Transduction Particles
F-box and leucine-rich repeat protein 18
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201342    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001033312.1-2434s1c1
Sequence:CCGGGAGTACAGTGACAAGAAGTAACTCGAGTTACTTCTTGTCACTGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033312.1-328s1c1
Sequence:CCGGGAAGGTGAAGCAACTGGTGAACTCGAGTTCACCAGTTGCTTCACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033312.1-2016s1c1
Sequence:CCGGGTCACATGTTCACCGGAGAATCTCGAGATTCTCCGGTGAACATGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033312.1-175s1c1
Sequence:CCGGCGATGAGATCCTCCTACACATCTCGAGATGTGTAGGAGGATCTCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190757    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001033312.1-2413s1c1
Sequence:CCGGGATTCTCTCTGTCACTCTCATCTCGAGATGAGAGTGACAGAGAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033312.1-1012s1c1
Sequence:CCGGGAAATTCAACAATCCCTTCTACTCGAGTAGAAGGGATTGTTGAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024963
FBXL18 MISSION shRNA Bacterial Glycerol Stock
F-box and leucine-rich repeat protein 18
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156908    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024963.2-109s1c1
Sequence:CCGGGATGATGATGACATGCACCCTCTCGAGAGGGTGCATGTCATCATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024963.2-1500s1c1
Sequence:CCGGGTTCTGGTCTCTGCTGAAGAACTCGAGTTCTTCAGCAGAGACCAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024963.2-1820s1c1
Sequence:CCGGCAGACATGTTGAAGCACTGCACTCGAGTGCAGTGCTTCAACATGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156286    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024963.2-667s1c1
Sequence:CCGGCTGCTGCTCTACTTCGAGATTCTCGAGAATCTCGAAGTAGAGCAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155419    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024963.2-2355s1c1
Sequence:CCGGCCCAACTTCTAGATTGGGAAACTCGAGTTTCCCAATCTAGAAGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024963.2-1020s1c1
Sequence:CCGGCAACCCGTTCTACTTCAGTTTCTCGAGAAACTGAAGTAGAACGGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024963.2-213s1c1
Sequence:CCGGCACAGATCTGATTCTGAACGTCTCGAGACGTTCAGAATCAGATCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024963.4-777s21c1
Sequence:CCGGAGAACCTGCGGGTCTTCTATGCTCGAGCATAGAAGACCCGCAGGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024963.4-2112s21c1
Sequence:CCGGCCGCGTTAAACGTCGTCATCTCTCGAGAGATGACGACGTTTAACGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024963.4-1011s21c1
Sequence:CCGGCCCTCCTGCAGCACATGAAATCTCGAGATTTCATGTGCTGCAGGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024963
FBXL18 MISSION shRNA shRNA Plasmid DNA
F-box and leucine-rich repeat protein 18
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156908    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024963.2-109s1c1
Sequence:CCGGGATGATGATGACATGCACCCTCTCGAGAGGGTGCATGTCATCATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024963.2-1500s1c1
Sequence:CCGGGTTCTGGTCTCTGCTGAAGAACTCGAGTTCTTCAGCAGAGACCAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024963.2-1820s1c1
Sequence:CCGGCAGACATGTTGAAGCACTGCACTCGAGTGCAGTGCTTCAACATGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156286    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024963.2-667s1c1
Sequence:CCGGCTGCTGCTCTACTTCGAGATTCTCGAGAATCTCGAAGTAGAGCAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155419    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024963.2-2355s1c1
Sequence:CCGGCCCAACTTCTAGATTGGGAAACTCGAGTTTCCCAATCTAGAAGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024963.2-1020s1c1
Sequence:CCGGCAACCCGTTCTACTTCAGTTTCTCGAGAAACTGAAGTAGAACGGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024963.2-213s1c1
Sequence:CCGGCACAGATCTGATTCTGAACGTCTCGAGACGTTCAGAATCAGATCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024963.4-777s21c1
Sequence:CCGGAGAACCTGCGGGTCTTCTATGCTCGAGCATAGAAGACCCGCAGGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024963.4-2112s21c1
Sequence:CCGGCCGCGTTAAACGTCGTCATCTCTCGAGAGATGACGACGTTTAACGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024963.4-1011s21c1
Sequence:CCGGCCCTCCTGCAGCACATGAAATCTCGAGATTTCATGTGCTGCAGGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024963
FBXL18 MISSION shRNA Lentiviral Transduction Particles
F-box and leucine-rich repeat protein 18
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156908    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024963.2-109s1c1
Sequence:CCGGGATGATGATGACATGCACCCTCTCGAGAGGGTGCATGTCATCATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024963.2-1500s1c1
Sequence:CCGGGTTCTGGTCTCTGCTGAAGAACTCGAGTTCTTCAGCAGAGACCAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024963.2-1820s1c1
Sequence:CCGGCAGACATGTTGAAGCACTGCACTCGAGTGCAGTGCTTCAACATGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156286    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024963.2-667s1c1
Sequence:CCGGCTGCTGCTCTACTTCGAGATTCTCGAGAATCTCGAAGTAGAGCAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155419    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024963.2-2355s1c1
Sequence:CCGGCCCAACTTCTAGATTGGGAAACTCGAGTTTCCCAATCTAGAAGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024963.2-1020s1c1
Sequence:CCGGCAACCCGTTCTACTTCAGTTTCTCGAGAAACTGAAGTAGAACGGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024963.2-213s1c1
Sequence:CCGGCACAGATCTGATTCTGAACGTCTCGAGACGTTCAGAATCAGATCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024963.4-777s21c1
Sequence:CCGGAGAACCTGCGGGTCTTCTATGCTCGAGCATAGAAGACCCGCAGGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024963.4-2112s21c1
Sequence:CCGGCCGCGTTAAACGTCGTCATCTCTCGAGAGATGACGACGTTTAACGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024963.4-1011s21c1
Sequence:CCGGCCCTCCTGCAGCACATGAAATCTCGAGATTTCATGTGCTGCAGGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks