EMAIL THIS PAGE TO A FRIEND

FBXL19-AS1

FBXL19 antisense RNA 1 (head to head)

32 Gene Product Result for
Synonyms: NCRNA00095
Species: Human FBXL19-AS1(283932)
UniProtKB ID: Q494R0, Q3KR42, Q8NAQ9
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175901 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_175901 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_175901 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XR_040474 Rosetta Predictions human pricing
XR_040475 Rosetta Predictions human pricing
XR_040476 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040474 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00519241 predicted 257
2 SASI_Hs02_00519242 predicted 224
3 SASI_Hs02_00519243 predicted 233
4 SASI_Hs02_00519244 predicted 692
5 SASI_Hs02_00519245 predicted 224
6 SASI_Hs02_00519246 predicted 231
7 SASI_Hs02_00519247 predicted 460
8 SASI_Hs02_00519248 predicted 326
9 SASI_Hs02_00519249 predicted 476
10 SASI_Hs02_00519250 predicted 245
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040475 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00519251 predicted 257
2 SASI_Hs02_00519252 predicted 223
3 SASI_Hs02_00519253 predicted 229
4 SASI_Hs02_00519254 predicted 692
5 SASI_Hs02_00519255 predicted 224
6 SASI_Hs02_00519256 predicted 224
7 SASI_Hs02_00519257 predicted 465
8 SASI_Hs02_00519258 predicted 325
9 SASI_Hs02_00519259 predicted 474
10 SASI_Hs02_00519260 predicted 245
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040476 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00519261 predicted 257
2 SASI_Hs02_00519262 predicted 223
3 SASI_Hs02_00519263 predicted 230
4 SASI_Hs02_00519264 predicted 686
5 SASI_Hs02_00519265 predicted 221
6 SASI_Hs02_00519266 predicted 226
7 SASI_Hs02_00519267 predicted 467
8 SASI_Hs02_00519268 predicted 332
9 SASI_Hs02_00519269 predicted 474
10 SASI_Hs02_00519270 predicted 242
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175901
FBXL19-AS1 MISSION shRNA Bacterial Glycerol Stock
FBXL19 antisense RNA 1 (head to head)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000165736    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175901.3-1946s1c1
Sequence:CCGGCCTCCCTAAGTGTTGGGATTACTCGAGTAATCCCAACACTTAGGGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159181    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175901.3-3539s1c1
Sequence:CCGGGCATTTAATTTGGCATAGCAACTCGAGTTGCTATGCCAAATTAAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161126    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175901.3-3551s1c1
Sequence:CCGGGCATAGCAACAACAACACATTCTCGAGAATGTGTTGTTGTTGCTATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162287    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175901.3-2364s1c1
Sequence:CCGGCCAAGTTCACTGTTCATCATTCTCGAGAATGATGAACAGTGAACTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163693    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175901.3-1269s1c1
Sequence:CCGGGCCAATGTTCTTGTCACCAAACTCGAGTTTGGTGACAAGAACATTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163919    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175901.3-2497s1c1
Sequence:CCGGCGGATCATGAAGTCAAGAGTTCTCGAGAACTCTTGACTTCATGATCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165707    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175901.3-1802s1c1
Sequence:CCGGCCTTGTGAATACCTGGGACTTCTCGAGAAGTCCCAGGTATTCACAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175901
FBXL19-AS1 MISSION shRNA shRNA Plasmid DNA
FBXL19 antisense RNA 1 (head to head)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000165736    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175901.3-1946s1c1
Sequence:CCGGCCTCCCTAAGTGTTGGGATTACTCGAGTAATCCCAACACTTAGGGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159181    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175901.3-3539s1c1
Sequence:CCGGGCATTTAATTTGGCATAGCAACTCGAGTTGCTATGCCAAATTAAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161126    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175901.3-3551s1c1
Sequence:CCGGGCATAGCAACAACAACACATTCTCGAGAATGTGTTGTTGTTGCTATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162287    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175901.3-2364s1c1
Sequence:CCGGCCAAGTTCACTGTTCATCATTCTCGAGAATGATGAACAGTGAACTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163693    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175901.3-1269s1c1
Sequence:CCGGGCCAATGTTCTTGTCACCAAACTCGAGTTTGGTGACAAGAACATTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163919    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175901.3-2497s1c1
Sequence:CCGGCGGATCATGAAGTCAAGAGTTCTCGAGAACTCTTGACTTCATGATCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165707    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175901.3-1802s1c1
Sequence:CCGGCCTTGTGAATACCTGGGACTTCTCGAGAAGTCCCAGGTATTCACAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175901
FBXL19-AS1 MISSION shRNA Lentiviral Transduction Particles
FBXL19 antisense RNA 1 (head to head)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000165736    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175901.3-1946s1c1
Sequence:CCGGCCTCCCTAAGTGTTGGGATTACTCGAGTAATCCCAACACTTAGGGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159181    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175901.3-3539s1c1
Sequence:CCGGGCATTTAATTTGGCATAGCAACTCGAGTTGCTATGCCAAATTAAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161126    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175901.3-3551s1c1
Sequence:CCGGGCATAGCAACAACAACACATTCTCGAGAATGTGTTGTTGTTGCTATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162287    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175901.3-2364s1c1
Sequence:CCGGCCAAGTTCACTGTTCATCATTCTCGAGAATGATGAACAGTGAACTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163693    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175901.3-1269s1c1
Sequence:CCGGGCCAATGTTCTTGTCACCAAACTCGAGTTTGGTGACAAGAACATTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163919    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175901.3-2497s1c1
Sequence:CCGGCGGATCATGAAGTCAAGAGTTCTCGAGAACTCTTGACTTCATGATCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165707    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175901.3-1802s1c1
Sequence:CCGGCCTTGTGAATACCTGGGACTTCTCGAGAAGTCCCAGGTATTCACAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)