EMAIL THIS PAGE TO A FRIEND

FBXL19

F-box and leucine-rich repeat protein 19

Synonyms: Fbl19 JHDM1C
UniProtKB ID: Q6PCT2, A8MT10, Q8N789, Q9NT14
Gene ID:
Human(54620) Summary: This gene encodes a member of the Skp1-Cullin-F-box family of E3 ubiquitin ligases. The encoded protein binds to the transmembrane receptor ST2L and regulates its ubiquination and degradation. This protein has been linked to the regulation of pulmonary inflammation and psoriasis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2012]
Mouse(233902) F-box and leucine-rich repeat protein 19
Rat(308999) F-box and leucine-rich repeat protein 19
dog(607324) F-box and leucine-rich repeat protein 19
domestic cat(101091581) F-box and leucine-rich repeat protein 19
Horse(100063588) F-box and leucine-rich repeat protein 19
cow(540981) F-box and leucine-rich repeat protein 19
domestic guinea pig(100732335) F-box and leucine-rich repeat protein 19
naked mole-rat(101704732) F-box and leucine-rich repeat protein 19
sheep(101104957) F-box and leucine-rich repeat protein 19
136 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001099784 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001099784 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001099784 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019085 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019085 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019085 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172748 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172748 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172748 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001099784 Rosetta Predictions human pricing
NM_019085 Rosetta Predictions human pricing
NM_001107552 Rosetta Predictions rat pricing
NM_172748 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099784 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00321458 predicted 2350
2 SASI_Hs02_00321459 predicted 1062
3 SASI_Hs02_00321460 predicted 1770
4 SASI_Hs02_00321461 predicted 2330
5 SASI_Hs02_00321462 predicted 2145
6 SASI_Hs02_00321463 predicted 1652
7 SASI_Hs02_00321464 predicted 1831
8 SASI_Hs02_00321465 predicted 1879
9 SASI_Hs02_00321466 predicted 1497
10 SASI_Hs02_00321467 predicted 2365
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019085 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00051298 predicted 1866
2 SASI_Hs01_00051299 predicted 1295
3 SASI_Hs01_00051300 predicted 1297
4 SASI_Hs01_00051301 predicted 1860
5 SASI_Hs01_00051302 predicted 1861
6 SASI_Hs01_00051303 predicted 1862
7 SASI_Hs01_00051304 predicted 1659
8 SASI_Hs01_00051305 predicted 1170
9 SASI_Hs01_00051306 predicted 1344
10 SASI_Hs01_00051307 predicted 1391
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107552 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00229955 predicted 358
2 SASI_Rn02_00229956 predicted 667
3 SASI_Rn02_00229957 predicted 1729
4 SASI_Rn02_00229958 predicted 434
5 SASI_Rn02_00229959 predicted 379
6 SASI_Rn02_00229960 predicted 892
7 SASI_Rn02_00229961 predicted 301
8 SASI_Rn02_00229962 predicted 1624
9 SASI_Rn02_00229963 predicted 1424
10 SASI_Rn02_00229964 predicted 542
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172748 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00038652 predicted 1322
2 SASI_Mm01_00038653 predicted 2832
3 SASI_Mm01_00038654 predicted 716
4 SASI_Mm02_00344587 predicted 1170
5 SASI_Mm01_00038656 predicted 1948
6 SASI_Mm01_00038657 predicted 1635
7 SASI_Mm01_00038658 predicted 2758
8 SASI_Mm01_00038659 predicted 2733
9 SASI_Mm01_00038660 predicted 1331
10 SASI_Mm01_00038661 predicted 2631
11 SASI_Mm01_00038655 predicted 2203
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001099784
FBXL19 MISSION shRNA Bacterial Glycerol Stock
F-box and leucine-rich repeat protein 19
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000359198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099784.2-1777s21c1
Sequence:CCGGGCTGGATCGAGGATGTTAAAGCTCGAGCTTTAACATCCTCGATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099784.2-486s21c1
Sequence:CCGGAGCCTCATGGAGTGTACAATCCTCGAGGATTGTACACTCCATGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359134    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099784.2-2660s21c1
Sequence:CCGGCAGGGAACAAAGACCAGTTACCTCGAGGTAACTGGTCTTTGTTCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001099784
FBXL19 MISSION shRNA shRNA Plasmid DNA
F-box and leucine-rich repeat protein 19
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000359198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099784.2-1777s21c1
Sequence:CCGGGCTGGATCGAGGATGTTAAAGCTCGAGCTTTAACATCCTCGATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099784.2-486s21c1
Sequence:CCGGAGCCTCATGGAGTGTACAATCCTCGAGGATTGTACACTCCATGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359134    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099784.2-2660s21c1
Sequence:CCGGCAGGGAACAAAGACCAGTTACCTCGAGGTAACTGGTCTTTGTTCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001099784
FBXL19 MISSION shRNA Lentiviral Transduction Particles
F-box and leucine-rich repeat protein 19
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000359198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099784.2-1777s21c1
Sequence:CCGGGCTGGATCGAGGATGTTAAAGCTCGAGCTTTAACATCCTCGATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099784.2-486s21c1
Sequence:CCGGAGCCTCATGGAGTGTACAATCCTCGAGGATTGTACACTCCATGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359134    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099784.2-2660s21c1
Sequence:CCGGCAGGGAACAAAGACCAGTTACCTCGAGGTAACTGGTCTTTGTTCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019085
FBXL19 MISSION shRNA Bacterial Glycerol Stock
F-box and leucine-rich repeat protein 19
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000062333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019085.1-1292s1c1
Sequence:CCGGCGCTGGATCGAGGATGTTAAACTCGAGTTTAACATCCTCGATCCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019085.1-511s1c1
Sequence:CCGGGCACCTGAAGAAGAAACCAAACTCGAGTTTGGTTTCTTCTTCAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019085.1-988s1c1
Sequence:CCGGGCGGGAGCTGTGTATCTGCATCTCGAGATGCAGATACACAGCTCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019085.1-1738s1c1
Sequence:CCGGGCTGCTTCTCAAGGACAGCTACTCGAGTAGCTGTCCTTGAGAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019085.1-1563s1c1
Sequence:CCGGTGCACCTCAATCTTGCTGGTTCTCGAGAACCAGCAAGATTGAGGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019085
FBXL19 MISSION shRNA shRNA Plasmid DNA
F-box and leucine-rich repeat protein 19
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000062333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019085.1-1292s1c1
Sequence:CCGGCGCTGGATCGAGGATGTTAAACTCGAGTTTAACATCCTCGATCCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019085.1-511s1c1
Sequence:CCGGGCACCTGAAGAAGAAACCAAACTCGAGTTTGGTTTCTTCTTCAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019085.1-988s1c1
Sequence:CCGGGCGGGAGCTGTGTATCTGCATCTCGAGATGCAGATACACAGCTCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019085.1-1738s1c1
Sequence:CCGGGCTGCTTCTCAAGGACAGCTACTCGAGTAGCTGTCCTTGAGAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019085.1-1563s1c1
Sequence:CCGGTGCACCTCAATCTTGCTGGTTCTCGAGAACCAGCAAGATTGAGGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019085
FBXL19 MISSION shRNA Lentiviral Transduction Particles
F-box and leucine-rich repeat protein 19
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000062333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019085.1-1292s1c1
Sequence:CCGGCGCTGGATCGAGGATGTTAAACTCGAGTTTAACATCCTCGATCCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019085.1-511s1c1
Sequence:CCGGGCACCTGAAGAAGAAACCAAACTCGAGTTTGGTTTCTTCTTCAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019085.1-988s1c1
Sequence:CCGGGCGGGAGCTGTGTATCTGCATCTCGAGATGCAGATACACAGCTCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019085.1-1738s1c1
Sequence:CCGGGCTGCTTCTCAAGGACAGCTACTCGAGTAGCTGTCCTTGAGAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019085.1-1563s1c1
Sequence:CCGGTGCACCTCAATCTTGCTGGTTCTCGAGAACCAGCAAGATTGAGGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172748
FBXL19 MISSION shRNA Bacterial Glycerol Stock
F-box and leucine-rich repeat protein 19
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000092453    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172748.2-3179s1c1
Sequence:CCGGGCTCTCTACACAATACTTGAACTCGAGTTCAAGTATTGTGTAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172748.2-1174s1c1
Sequence:CCGGGAGAAACCAAAGCCACCTATACTCGAGTATAGGTGGCTTTGGTTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172748.2-1942s1c1
Sequence:CCGGCTCCGCTGGATTGAAGATGTTCTCGAGAACATCTTCAATCCAGCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172748.2-1945s1c1
Sequence:CCGGCGCTGGATTGAAGATGTTAAACTCGAGTTTAACATCTTCAATCCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172748.2-642s1c1
Sequence:CCGGGAAGTTTAGTTTGAGCCTCATCTCGAGATGAGGCTCAAACTAAACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172748
FBXL19 MISSION shRNA shRNA Plasmid DNA
F-box and leucine-rich repeat protein 19
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000092453    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172748.2-3179s1c1
Sequence:CCGGGCTCTCTACACAATACTTGAACTCGAGTTCAAGTATTGTGTAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172748.2-1174s1c1
Sequence:CCGGGAGAAACCAAAGCCACCTATACTCGAGTATAGGTGGCTTTGGTTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172748.2-1942s1c1
Sequence:CCGGCTCCGCTGGATTGAAGATGTTCTCGAGAACATCTTCAATCCAGCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172748.2-1945s1c1
Sequence:CCGGCGCTGGATTGAAGATGTTAAACTCGAGTTTAACATCTTCAATCCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172748.2-642s1c1
Sequence:CCGGGAAGTTTAGTTTGAGCCTCATCTCGAGATGAGGCTCAAACTAAACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172748
FBXL19 MISSION shRNA Lentiviral Transduction Particles
F-box and leucine-rich repeat protein 19
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000092453    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172748.2-3179s1c1
Sequence:CCGGGCTCTCTACACAATACTTGAACTCGAGTTCAAGTATTGTGTAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172748.2-1174s1c1
Sequence:CCGGGAGAAACCAAAGCCACCTATACTCGAGTATAGGTGGCTTTGGTTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172748.2-1942s1c1
Sequence:CCGGCTCCGCTGGATTGAAGATGTTCTCGAGAACATCTTCAATCCAGCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172748.2-1945s1c1
Sequence:CCGGCGCTGGATTGAAGATGTTAAACTCGAGTTTAACATCTTCAATCCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172748.2-642s1c1
Sequence:CCGGGAAGTTTAGTTTGAGCCTCATCTCGAGATGAGGCTCAAACTAAACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks