EMAIL THIS PAGE TO A FRIEND

FBXL20

F-box and leucine-rich repeat protein 20

203 Gene Product Result for
Synonyms: Fbl2 Fbl20
UniProtKB ID: Q96IG2, A8K729, Q38J52
Gene ID:
Human(84961) Summary: Members of the F-box protein family, such as FBXL20, are characterized by an approximately 40-amino acid F-box motif. SCF complexes, formed by SKP1 (MIM 601434), cullin (see CUL1; MIM 603134), and F-box proteins, act as protein-ubiquitin ligases. F-box proteins interact with SKP1 through the F box, and they interact with ubiquitination targets through other protein interaction domains (Jin et al., 2004 [PubMed 15520277]
Mouse(72194) F-box and leucine-rich repeat protein 20
Rat(64039) F-box and leucine-rich repeat protein 20
domestic guinea pig(100722528) F-box and leucine-rich repeat protein 20
naked mole-rat(101712550) F-box and leucine-rich repeat protein 20
sheep(101101999) F-box and leucine-rich repeat protein 20
Zebrafish(100331130) F-box and leucine-rich repeat protein 20
domestic cat(101089726) F-box and leucine-rich repeat protein 20
Horse(100068335) F-box and leucine-rich repeat protein 20
cow(511007) F-box and leucine-rich repeat protein 20
dog(612832) F-box and leucine-rich repeat protein 20
chicken(771869) F-box and leucine-rich repeat protein 20
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028149 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028149 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028149 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032875 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032875 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032875 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_126674 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_126674 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_126674 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032875 Rosetta Predictions human pricing
NM_022272 Rosetta Predictions rat pricing
NM_028149 Rosetta Predictions mouse pricing
XM_001000358 Rosetta Predictions mouse pricing
XM_126674 Rosetta Predictions mouse pricing
XM_895145 Rosetta Predictions mouse pricing
XM_903026 Rosetta Predictions mouse pricing
XM_903028 Rosetta Predictions mouse pricing
XM_903031 Rosetta Predictions mouse pricing
XM_903032 Rosetta Predictions mouse pricing
XM_903033 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032875 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00024959 predicted 899
2 SASI_Hs01_00024961 predicted 921
3 SASI_Hs01_00024963 predicted 632
4 SASI_Hs01_00024964 predicted 951
5 SASI_Hs01_00024965 predicted 586
6 SASI_Hs02_00360489 predicted 1387
7 SASI_Hs01_00024966 predicted 720
8 SASI_Hs01_00024967 predicted 572
9 SASI_Hs01_00024968 predicted 766
10 SASI_Hs02_00360490 predicted 1192
11 SASI_Hs01_00024960 predicted 1157
12 SASI_Hs01_00024962 predicted 1312
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022272 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00042372 predicted 359
2 SASI_Rn01_00042373 predicted 297
3 SASI_Rn01_00042374 predicted 366
4 SASI_Rn01_00042375 predicted 360
5 SASI_Rn01_00042376 predicted 320
6 SASI_Rn01_00042377 predicted 548
7 SASI_Rn01_00042378 predicted 445
8 SASI_Rn02_00263080 predicted 579
9 SASI_Rn01_00042379 predicted 546
10 SASI_Rn01_00042380 predicted 398
11 SASI_Rn01_00042381 predicted 531
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028149 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00333417 predicted 1577
2 SASI_Mm02_00333418 predicted 613
3 SASI_Mm02_00333419 predicted 1266
4 SASI_Mm02_00333420 predicted 1216
5 SASI_Mm02_00333421 predicted 457
6 SASI_Mm02_00333422 predicted 442
7 SASI_Mm02_00333423 predicted 1343
8 SASI_Mm02_00333424 predicted 1428
9 SASI_Mm02_00333425 predicted 979
10 SASI_Mm02_00333426 predicted 989
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001000358 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00223817 predicted 1394
2 SASI_Mm01_00223818 predicted 435
3 SASI_Mm01_00223819 predicted 1076
4 SASI_Mm01_00223820 predicted 1031
5 SASI_Mm01_00223821 predicted 268
6 SASI_Mm01_00223822 predicted 260
7 SASI_Mm01_00223823 predicted 1160
8 SASI_Mm01_00223824 predicted 1248
9 SASI_Mm01_00223825 predicted 796
10 SASI_Mm01_00223826 predicted 1404
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_126674 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00228199 predicted 1588
2 SASI_Mm01_00228200 predicted 630
3 SASI_Mm01_00228201 predicted 1269
4 SASI_Mm01_00228202 predicted 1229
5 SASI_Mm01_00228203 predicted 468
6 SASI_Mm01_00228204 predicted 449
7 SASI_Mm01_00228205 predicted 1356
8 SASI_Mm01_00228206 predicted 1436
9 SASI_Mm01_00228207 predicted 984
10 SASI_Mm01_00228208 predicted 1596
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_895145 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00255743 predicted 1617
2 SASI_Mm01_00255744 predicted 654
3 SASI_Mm01_00255745 predicted 1294
4 SASI_Mm01_00255746 predicted 1255
5 SASI_Mm01_00255747 predicted 485
6 SASI_Mm01_00255748 predicted 470
7 SASI_Mm01_00255749 predicted 339
8 SASI_Mm01_00255750 predicted 1382
9 SASI_Mm01_00255751 predicted 1454
10 SASI_Mm01_00255752 predicted 1007
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_903026 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00222916 predicted 428
2 SASI_Mm01_00222917 predicted 478
3 SASI_Mm01_00222918 predicted 1084
4 SASI_Mm01_00222919 predicted 1031
5 SASI_Mm01_00222920 predicted 268
6 SASI_Mm01_00222921 predicted 258
7 SASI_Mm01_00222922 predicted 1161
8 SASI_Mm01_00222923 predicted 1238
9 SASI_Mm01_00222924 predicted 792
10 SASI_Mm01_00222925 predicted 1189
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_903028 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00216233 predicted 1400
2 SASI_Mm01_00216234 predicted 434
3 SASI_Mm01_00216235 predicted 1077
4 SASI_Mm01_00216236 predicted 1036
5 SASI_Mm01_00216237 predicted 268
6 SASI_Mm01_00216238 predicted 252
7 SASI_Mm01_00216239 predicted 1161
8 SASI_Mm01_00216240 predicted 1238
9 SASI_Mm01_00216241 predicted 793
10 SASI_Mm01_00216242 predicted 1404
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_903031 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00239644 predicted 433
2 SASI_Mm01_00239645 predicted 479
3 SASI_Mm01_00239646 predicted 395
4 SASI_Mm01_00239647 predicted 275
5 SASI_Mm01_00239648 predicted 259
6 SASI_Mm01_00239649 predicted 444
7 SASI_Mm01_00239650 predicted 790
8 SASI_Mm01_00239651 predicted 809
9 SASI_Mm01_00239652 predicted 573
10 SASI_Mm01_00239653 predicted 879
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_903032 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00202730 predicted 1618
2 SASI_Mm01_00202731 predicted 1301
3 SASI_Mm01_00202732 predicted 1260
4 SASI_Mm01_00202733 predicted 1387
5 SASI_Mm01_00202734 predicted 1466
6 SASI_Mm01_00202735 predicted 1012
7 SASI_Mm01_00202736 predicted 1028
8 SASI_Mm01_00202737 predicted 1628
9 SASI_Mm01_00202738 predicted 1412
10 SASI_Mm01_00202739 predicted 794
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_903033 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00263755 predicted 1327
2 SASI_Mm01_00263756 predicted 1009
3 SASI_Mm01_00263757 predicted 958
4 SASI_Mm01_00263758 predicted 1091
5 SASI_Mm01_00263759 predicted 1175
6 SASI_Mm01_00263760 predicted 727
7 SASI_Mm01_00263761 predicted 740
8 SASI_Mm01_00263762 predicted 1331
9 SASI_Mm01_00263763 predicted 1116
10 SASI_Mm01_00263764 predicted 507
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028149
FBXL20 MISSION shRNA Bacterial Glycerol Stock
F-box and leucine-rich repeat protein 20
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350173    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028149.1-1586s21c1
Sequence:CCGGCCATGTTGAACTGAGTATTTACTCGAGTAAATACTCAGTTCAACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028149.1-317s21c1
Sequence:CCGGGATGAGGCTGTAATCAATAAACTCGAGTTTATTGATTACAGCCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028149.1-607s21c1
Sequence:CCGGTAGGAATATTGAAGTACTAAGCTCGAGCTTAGTACTTCAATATTCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216606    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028149.1-1192s1c1
Sequence:CCGGGATCACGGATAGCACATTAATCTCGAGATTAATGTGCTATCCGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217329    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028149.1-350s1c1
Sequence:CCGGGAACTCCTGTTGAGGATATTTCTCGAGAAATATCCTCAACAGGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217917    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028149.1-1461s1c1
Sequence:CCGGGGACCCATTTACCCAACATTACTCGAGTAATGTTGGGTAAATGGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028149.1-707s21c1
Sequence:CCGGTTGGCTTCCTGTACGTCAATACTCGAGTATTGACGTACAGGAAGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028149.1-918s21c1
Sequence:CCGGGCCCTGAGCTAGTGACTTTAACTCGAGTTAAAGTCACTAGCTCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028149
FBXL20 MISSION shRNA shRNA Plasmid DNA
F-box and leucine-rich repeat protein 20
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350173    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028149.1-1586s21c1
Sequence:CCGGCCATGTTGAACTGAGTATTTACTCGAGTAAATACTCAGTTCAACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028149.1-317s21c1
Sequence:CCGGGATGAGGCTGTAATCAATAAACTCGAGTTTATTGATTACAGCCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028149.1-607s21c1
Sequence:CCGGTAGGAATATTGAAGTACTAAGCTCGAGCTTAGTACTTCAATATTCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216606    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028149.1-1192s1c1
Sequence:CCGGGATCACGGATAGCACATTAATCTCGAGATTAATGTGCTATCCGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217329    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028149.1-350s1c1
Sequence:CCGGGAACTCCTGTTGAGGATATTTCTCGAGAAATATCCTCAACAGGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217917    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028149.1-1461s1c1
Sequence:CCGGGGACCCATTTACCCAACATTACTCGAGTAATGTTGGGTAAATGGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028149.1-707s21c1
Sequence:CCGGTTGGCTTCCTGTACGTCAATACTCGAGTATTGACGTACAGGAAGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028149.1-918s21c1
Sequence:CCGGGCCCTGAGCTAGTGACTTTAACTCGAGTTAAAGTCACTAGCTCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028149
FBXL20 MISSION shRNA Lentiviral Transduction Particles
F-box and leucine-rich repeat protein 20
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350173    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028149.1-1586s21c1
Sequence:CCGGCCATGTTGAACTGAGTATTTACTCGAGTAAATACTCAGTTCAACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028149.1-317s21c1
Sequence:CCGGGATGAGGCTGTAATCAATAAACTCGAGTTTATTGATTACAGCCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028149.1-607s21c1
Sequence:CCGGTAGGAATATTGAAGTACTAAGCTCGAGCTTAGTACTTCAATATTCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216606    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028149.1-1192s1c1
Sequence:CCGGGATCACGGATAGCACATTAATCTCGAGATTAATGTGCTATCCGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217329    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028149.1-350s1c1
Sequence:CCGGGAACTCCTGTTGAGGATATTTCTCGAGAAATATCCTCAACAGGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217917    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028149.1-1461s1c1
Sequence:CCGGGGACCCATTTACCCAACATTACTCGAGTAATGTTGGGTAAATGGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028149.1-707s21c1
Sequence:CCGGTTGGCTTCCTGTACGTCAATACTCGAGTATTGACGTACAGGAAGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028149.1-918s21c1
Sequence:CCGGGCCCTGAGCTAGTGACTTTAACTCGAGTTAAAGTCACTAGCTCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032875
VALIDATED
FBXL20 MISSION shRNA Bacterial Glycerol Stock
F-box and leucine-rich repeat protein 20
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000327648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032875.1-457s21c1
Sequence:CCGGGCCGAGTAGTGGAGAATATTTCTCGAGAAATATTCTCCACTACTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327649    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032875.1-2128s21c1
Sequence:CCGGCCTAAATGGTTGCCTTGAAATCTCGAGATTTCAAGGCAACCATTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032875.1-927s21c1
Sequence:CCGGGATGAAGGTCTCATTACTATACTCGAGTATAGTAATGAGACCTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032875.1-312s21c1
Sequence:CCGGGAACTCCTGTTACGGATATTTCTCGAGAAATATCCGTAACAGGAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032875.1-1422s21c1
Sequence:CCGGAGGACCCATTTACCCAATATTCTCGAGAATATTGGGTAAATGGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073318    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_032875.1-2128s1c1
Sequence:CCGGCCTAAATGGTTGCCTTGAAATCTCGAGATTTCAAGGCAACCATTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032875.1-1104s1c1
Sequence:CCGGGCCAGGAATTGCCATGAACTTCTCGAGAAGTTCATGGCAATTCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032875.1-633s1c1
Sequence:CCGGCTTAGCAAGTTCTGTTCCAAACTCGAGTTTGGAACAGAACTTGCTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_032875.1-1312s1c1
Sequence:CCGGGCCCACTAATCACAGATGCATCTCGAGATGCATCTGTGATTAGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_032875.1-457s1c1
Sequence:CCGGGCCGAGTAGTGGAGAATATTTCTCGAGAAATATTCTCCACTACTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032875
VALIDATED
FBXL20 MISSION shRNA shRNA Plasmid DNA
F-box and leucine-rich repeat protein 20
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000327648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032875.1-457s21c1
Sequence:CCGGGCCGAGTAGTGGAGAATATTTCTCGAGAAATATTCTCCACTACTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327649    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032875.1-2128s21c1
Sequence:CCGGCCTAAATGGTTGCCTTGAAATCTCGAGATTTCAAGGCAACCATTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032875.1-927s21c1
Sequence:CCGGGATGAAGGTCTCATTACTATACTCGAGTATAGTAATGAGACCTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032875.1-312s21c1
Sequence:CCGGGAACTCCTGTTACGGATATTTCTCGAGAAATATCCGTAACAGGAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032875.1-1422s21c1
Sequence:CCGGAGGACCCATTTACCCAATATTCTCGAGAATATTGGGTAAATGGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073318    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_032875.1-2128s1c1
Sequence:CCGGCCTAAATGGTTGCCTTGAAATCTCGAGATTTCAAGGCAACCATTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032875.1-1104s1c1
Sequence:CCGGGCCAGGAATTGCCATGAACTTCTCGAGAAGTTCATGGCAATTCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032875.1-633s1c1
Sequence:CCGGCTTAGCAAGTTCTGTTCCAAACTCGAGTTTGGAACAGAACTTGCTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_032875.1-1312s1c1
Sequence:CCGGGCCCACTAATCACAGATGCATCTCGAGATGCATCTGTGATTAGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_032875.1-457s1c1
Sequence:CCGGGCCGAGTAGTGGAGAATATTTCTCGAGAAATATTCTCCACTACTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032875
VALIDATED
FBXL20 MISSION shRNA Lentiviral Transduction Particles
F-box and leucine-rich repeat protein 20
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000327648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032875.1-457s21c1
Sequence:CCGGGCCGAGTAGTGGAGAATATTTCTCGAGAAATATTCTCCACTACTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327649    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032875.1-2128s21c1
Sequence:CCGGCCTAAATGGTTGCCTTGAAATCTCGAGATTTCAAGGCAACCATTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032875.1-927s21c1
Sequence:CCGGGATGAAGGTCTCATTACTATACTCGAGTATAGTAATGAGACCTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032875.1-312s21c1
Sequence:CCGGGAACTCCTGTTACGGATATTTCTCGAGAAATATCCGTAACAGGAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032875.1-1422s21c1
Sequence:CCGGAGGACCCATTTACCCAATATTCTCGAGAATATTGGGTAAATGGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073318    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_032875.1-2128s1c1
Sequence:CCGGCCTAAATGGTTGCCTTGAAATCTCGAGATTTCAAGGCAACCATTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032875.1-1104s1c1
Sequence:CCGGGCCAGGAATTGCCATGAACTTCTCGAGAAGTTCATGGCAATTCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032875.1-633s1c1
Sequence:CCGGCTTAGCAAGTTCTGTTCCAAACTCGAGTTTGGAACAGAACTTGCTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_032875.1-1312s1c1
Sequence:CCGGGCCCACTAATCACAGATGCATCTCGAGATGCATCTGTGATTAGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_032875.1-457s1c1
Sequence:CCGGGCCGAGTAGTGGAGAATATTTCTCGAGAAATATTCTCCACTACTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_126674
VALIDATED
FBXL20 MISSION shRNA Bacterial Glycerol Stock
F-box and leucine-rich repeat protein 20
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000092363    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_126674.5-1560s1c1
Sequence:CCGGCCCACCATGTTGAACTGAGTACTCGAGTACTCAGTTCAACATGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:XM_126674.5-896s1c1
Sequence:CCGGGCCCTGAGCTAGTGACTTTAACTCGAGTTAAAGTCACTAGCTCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:XM_126674.5-648s1c1
Sequence:CCGGCCTTAGCAAGTTCTGCTCCAACTCGAGTTGGAGCAGAACTTGCTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:XM_126674.5-1213s1c1
Sequence:CCGGCGGCTTCAAGTGTTGAGTCTTCTCGAGAAGACTCAACACTTGAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:XM_126674.5-295s1c1
Sequence:CCGGGATGAGGCTGTAATCAATAAACTCGAGTTTATTGATTACAGCCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_126674
VALIDATED
FBXL20 MISSION shRNA shRNA Plasmid DNA
F-box and leucine-rich repeat protein 20
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000092363    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_126674.5-1560s1c1
Sequence:CCGGCCCACCATGTTGAACTGAGTACTCGAGTACTCAGTTCAACATGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:XM_126674.5-896s1c1
Sequence:CCGGGCCCTGAGCTAGTGACTTTAACTCGAGTTAAAGTCACTAGCTCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:XM_126674.5-648s1c1
Sequence:CCGGCCTTAGCAAGTTCTGCTCCAACTCGAGTTGGAGCAGAACTTGCTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:XM_126674.5-1213s1c1
Sequence:CCGGCGGCTTCAAGTGTTGAGTCTTCTCGAGAAGACTCAACACTTGAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:XM_126674.5-295s1c1
Sequence:CCGGGATGAGGCTGTAATCAATAAACTCGAGTTTATTGATTACAGCCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_126674
VALIDATED
FBXL20 MISSION shRNA Lentiviral Transduction Particles
F-box and leucine-rich repeat protein 20
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000092363    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_126674.5-1560s1c1
Sequence:CCGGCCCACCATGTTGAACTGAGTACTCGAGTACTCAGTTCAACATGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:XM_126674.5-896s1c1
Sequence:CCGGGCCCTGAGCTAGTGACTTTAACTCGAGTTAAAGTCACTAGCTCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:XM_126674.5-648s1c1
Sequence:CCGGCCTTAGCAAGTTCTGCTCCAACTCGAGTTGGAGCAGAACTTGCTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:XM_126674.5-1213s1c1
Sequence:CCGGCGGCTTCAAGTGTTGAGTCTTCTCGAGAAGACTCAACACTTGAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:XM_126674.5-295s1c1
Sequence:CCGGGATGAGGCTGTAATCAATAAACTCGAGTTTATTGATTACAGCCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks