EMAIL THIS PAGE TO A FRIEND

FBXL21

F-box and leucine-rich repeat protein 21 (gene/pseudogene)

35 Gene Product Result for
Synonyms: FBL3B FBXL3B FBXL3P Fbl21
UniProtKB ID: Q9UKT6
Gene ID:
Human(26223) Summary: This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbls class and, in addition to an F-box, contains 6 tandem leucine-rich repeats. The amino acid sequence of this protein is highly similar to that of f-box and leucine-rich repeat protein 3A. Comparisons of this gene to orthologous sequences suggest that it may be a pseudogene, and may no longer express a functional protein.[provided by RefSeq, Aug 2009]
Mouse(213311) F-box and leucine-rich repeat protein 21
chicken(416306) F-box and leucine-rich repeat protein 21
cow(505624) F-box and leucine-rich repeat protein 21
domestic cat(101080761) F-box and leucine-rich repeat protein 21
Horse(100062673) F-box and leucine-rich repeat protein 21
dog(610104) F-box and leucine-rich repeat protein 21
sheep(100169936) F-box and leucine-rich repeat protein 21
naked mole-rat(101704018) F-box and leucine-rich repeat protein 21
domestic guinea pig(100716741) F-box and leucine-rich repeat protein 21
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
WH0026223M2 Monoclonal Anti-FBXL21 antibody produced in mouse clone 4A1, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178674 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178674 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178674 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_012159 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012159 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012159 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012159 Rosetta Predictions human pricing
NM_178674 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012159 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00225895 predicted 892
2 SASI_Hs01_00225896 predicted 631
3 SASI_Hs02_00343745 predicted 362
4 SASI_Hs01_00225897 predicted 1035
5 SASI_Hs01_00225898 predicted 1046
6 SASI_Hs02_00343746 predicted 900
7 SASI_Hs01_00225899 predicted 588
8 SASI_Hs01_00225900 predicted 1034
9 SASI_Hs01_00225901 predicted 711
10 SASI_Hs01_00225902 predicted 606
11 SASI_Hs01_00225903 predicted 864
12 SASI_Hs01_00225904 predicted 626
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178674 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00192365 predicted 1226
2 SASI_Mm01_00192366 predicted 1054
3 SASI_Mm01_00192367 predicted 608
4 SASI_Mm01_00192368 predicted 1150
5 SASI_Mm01_00192369 predicted 1251
6 SASI_Mm01_00192370 predicted 697
7 SASI_Mm01_00192371 predicted 504
8 SASI_Mm02_00349137 predicted 602
9 SASI_Mm01_00192373 predicted 601
10 SASI_Mm01_00192374 predicted 616
11 SASI_Mm01_00192372 predicted 749
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178674
FBXL21 MISSION shRNA Bacterial Glycerol Stock
F-box and leucine-rich repeat protein 21 (gene/pseudogene)
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000092568    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178674.2-1325s1c1
Sequence:CCGGCGCATGTGTAAGTGAACGTATCTCGAGATACGTTCACTTACACATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178674.2-647s1c1
Sequence:CCGGCTCATTCAACAGATCATCAAACTCGAGTTTGATGATCTGTTGAATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178674.2-468s1c1
Sequence:CCGGCTTTACCTCACCATGTCATATCTCGAGATATGACATGGTGAGGTAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178674.2-572s1c1
Sequence:CCGGCCTGATCTTTGGAGGAAGTTTCTCGAGAAACTTCCTCCAAAGATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178674.2-607s1c1
Sequence:CCGGCCAATCAGCAACTTCTTATTTCTCGAGAAATAAGAAGTTGCTGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434840    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178674.4-1729s21c1
Sequence:CCGGGCTCAAGTAATTTAGGTTAAACTCGAGTTTAACCTAAATTACTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178674.4-1157s21c1
Sequence:CCGGGATCAAGTTCCATTCTATTAACTCGAGTTAATAGAATGGAACTTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178674
FBXL21 MISSION shRNA shRNA Plasmid DNA
F-box and leucine-rich repeat protein 21 (gene/pseudogene)
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000092568    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178674.2-1325s1c1
Sequence:CCGGCGCATGTGTAAGTGAACGTATCTCGAGATACGTTCACTTACACATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178674.2-647s1c1
Sequence:CCGGCTCATTCAACAGATCATCAAACTCGAGTTTGATGATCTGTTGAATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178674.2-468s1c1
Sequence:CCGGCTTTACCTCACCATGTCATATCTCGAGATATGACATGGTGAGGTAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178674.2-572s1c1
Sequence:CCGGCCTGATCTTTGGAGGAAGTTTCTCGAGAAACTTCCTCCAAAGATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178674.2-607s1c1
Sequence:CCGGCCAATCAGCAACTTCTTATTTCTCGAGAAATAAGAAGTTGCTGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434840    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178674.4-1729s21c1
Sequence:CCGGGCTCAAGTAATTTAGGTTAAACTCGAGTTTAACCTAAATTACTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178674.4-1157s21c1
Sequence:CCGGGATCAAGTTCCATTCTATTAACTCGAGTTAATAGAATGGAACTTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178674
FBXL21 MISSION shRNA Lentiviral Transduction Particles
F-box and leucine-rich repeat protein 21 (gene/pseudogene)
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000092568    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178674.2-1325s1c1
Sequence:CCGGCGCATGTGTAAGTGAACGTATCTCGAGATACGTTCACTTACACATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178674.2-647s1c1
Sequence:CCGGCTCATTCAACAGATCATCAAACTCGAGTTTGATGATCTGTTGAATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178674.2-468s1c1
Sequence:CCGGCTTTACCTCACCATGTCATATCTCGAGATATGACATGGTGAGGTAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178674.2-572s1c1
Sequence:CCGGCCTGATCTTTGGAGGAAGTTTCTCGAGAAACTTCCTCCAAAGATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178674.2-607s1c1
Sequence:CCGGCCAATCAGCAACTTCTTATTTCTCGAGAAATAAGAAGTTGCTGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434840    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178674.4-1729s21c1
Sequence:CCGGGCTCAAGTAATTTAGGTTAAACTCGAGTTTAACCTAAATTACTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178674.4-1157s21c1
Sequence:CCGGGATCAAGTTCCATTCTATTAACTCGAGTTAATAGAATGGAACTTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012159
FBXL21 MISSION shRNA Bacterial Glycerol Stock
F-box and leucine-rich repeat protein 21 (gene/pseudogene)
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000004286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012159.x-1180s1c1
Sequence:CCGGAGACTGTGTGAGAGAAGGTTACTCGAGTAACCTTCTCTCACACAGTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012159.x-688s1c1
Sequence:CCGGCTTTGTGTAGCTGACCGTTGTCTCGAGACAACGGTCAGCTACACAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012159.x-963s1c1
Sequence:CCGGCCCTGTTACTCACCTTTATTTCTCGAGAAATAAAGGTGAGTAACAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012159.x-988s1c1
Sequence:CCGGCGTTCAGTCAGCAAAGTGGTTCTCGAGAACCACTTTGCTGACTGAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012159
FBXL21 MISSION shRNA shRNA Plasmid DNA
F-box and leucine-rich repeat protein 21 (gene/pseudogene)
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000004286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012159.x-1180s1c1
Sequence:CCGGAGACTGTGTGAGAGAAGGTTACTCGAGTAACCTTCTCTCACACAGTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012159.x-688s1c1
Sequence:CCGGCTTTGTGTAGCTGACCGTTGTCTCGAGACAACGGTCAGCTACACAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012159.x-963s1c1
Sequence:CCGGCCCTGTTACTCACCTTTATTTCTCGAGAAATAAAGGTGAGTAACAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012159.x-988s1c1
Sequence:CCGGCGTTCAGTCAGCAAAGTGGTTCTCGAGAACCACTTTGCTGACTGAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012159
FBXL21 MISSION shRNA Lentiviral Transduction Particles
F-box and leucine-rich repeat protein 21 (gene/pseudogene)
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000004286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012159.x-1180s1c1
Sequence:CCGGAGACTGTGTGAGAGAAGGTTACTCGAGTAACCTTCTCTCACACAGTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012159.x-688s1c1
Sequence:CCGGCTTTGTGTAGCTGACCGTTGTCTCGAGACAACGGTCAGCTACACAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012159.x-963s1c1
Sequence:CCGGCCCTGTTACTCACCTTTATTTCTCGAGAAATAAAGGTGAGTAACAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012159.x-988s1c1
Sequence:CCGGCGTTCAGTCAGCAAAGTGGTTCTCGAGAACCACTTTGCTGACTGAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks