EMAIL THIS PAGE TO A FRIEND

FBXL2

F-box and leucine-rich repeat protein 2

110 Gene Product Result for
Synonyms: FBL2 FBL3
Gene ID:
Human(25827) Summary: This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbls class and, in addition to an F-box, contains 12 tandem leucine-rich repeats. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2010]
Mouse(72179) F-box and leucine-rich repeat protein 2
Rat(363156) F-box and leucine-rich repeat protein 2
Zebrafish(378737) F-box and leucine-rich repeat protein 2
dog(485573) F-box and leucine-rich repeat protein 2
cow(616212) F-box and leucine-rich repeat protein 2
domestic cat(101093885) F-box and leucine-rich repeat protein 2
chicken(420722) F-box and leucine-rich repeat protein 2
sheep(101113704) F-box and leucine-rich repeat protein 2
naked mole-rat(101717592) F-box and leucine-rich repeat protein 2
domestic guinea pig(100719708) F-box and leucine-rich repeat protein 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012157 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012157 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012157 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178624 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178624 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178624 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU011641 MISSION® esiRNA esiRNA targeting human FBXL2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012157 Rosetta Predictions human pricing
XM_001076670 Rosetta Predictions rat pricing
XM_343495 Rosetta Predictions rat pricing
NM_178624 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012157 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00059266 predicted 471
2 SASI_Hs01_00059267 predicted 676
3 SASI_Hs01_00059268 predicted 354
4 SASI_Hs02_00343743 predicted 1044
5 SASI_Hs02_00343744 predicted 938
6 SASI_Hs01_00059269 predicted 427
7 SASI_Hs01_00059270 predicted 1198
8 SASI_Hs01_00059272 predicted 994
9 SASI_Hs01_00059273 predicted 977
10 SASI_Hs01_00059275 predicted 1372
11 SASI_Hs01_00059271 predicted 993
12 SASI_Hs01_00059274 predicted 221
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076670 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00354070 predicted 1049
2 SASI_Rn02_00354071 predicted 775
3 SASI_Rn02_00354072 predicted 717
4 SASI_Rn02_00354073 predicted 461
5 SASI_Rn02_00354074 predicted 758
6 SASI_Rn02_00354075 predicted 496
7 SASI_Rn02_00354076 predicted 782
8 SASI_Rn02_00354077 predicted 803
9 SASI_Rn02_00354078 predicted 706
10 SASI_Rn02_00354079 predicted 1449
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343495 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00395884 predicted 893
2 SASI_Rn02_00395885 predicted 891
3 SASI_Rn02_00395886 predicted 895
4 SASI_Rn02_00395887 predicted 916
5 SASI_Rn02_00395888 predicted 1449
6 SASI_Rn02_00395889 predicted 1443
7 SASI_Rn02_00395890 predicted 1451
8 SASI_Rn02_00395891 predicted 1441
9 SASI_Rn02_00395892 predicted 899
10 SASI_Rn02_00395893 predicted 1444
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178624 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00348986 predicted 336
2 SASI_Mm01_00161790 predicted 1435
3 SASI_Mm01_00161791 predicted 1453
4 SASI_Mm01_00161792 predicted 1590
5 SASI_Mm01_00161793 predicted 461
6 SASI_Mm01_00161794 predicted 1456
7 SASI_Mm01_00161795 predicted 476
8 SASI_Mm01_00161796 predicted 417
9 SASI_Mm01_00161797 predicted 1438
10 SASI_Mm01_00161798 predicted 377
11 SASI_Mm01_00161799 predicted 432
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012157
VALIDATED
FBXL2 MISSION shRNA Bacterial Glycerol Stock
F-box and leucine-rich repeat protein 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000004276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012157.x-398s1c1
Sequence:CCGGGAACCTCAATGGATGCACAAACTCGAGTTTGTGCATCCATTGAGGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012157.x-965s1c1
Sequence:CCGGGATAACCGACAGCACACTCATCTCGAGATGAGTGTGCTGTCGGTTATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004279    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012157.x-1748s1c1
Sequence:CCGGTGGCCTACTTTAATTCACAATCTCGAGATTGTGAATTAAAGTAGGCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012157.x-494s1c1
Sequence:CCGGGTCTATTACAAACAGCTCCTTCTCGAGAAGGAGCTGTTTGTAATAGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012157.x-990s1c1
Sequence:CCGGCTCTCCATTCACTGTCCTAAACTCGAGTTTAGGACAGTGAATGGAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012157.2-398s21c1
Sequence:CCGGGAACCTCAATGGATGCACAAACTCGAGTTTGTGCATCCATTGAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012157.2-915s21c1
Sequence:CCGGGCTCGGAATTGCCACGAATTGCTCGAGCAATTCGTGGCAATTCCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012157.2-990s21c1
Sequence:CCGGCTCTCCATTCACTGTCCTAAACTCGAGTTTAGGACAGTGAATGGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279840    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012157.2-1748s21c1
Sequence:CCGGTGGCCTACTTTAATTCACAATCTCGAGATTGTGAATTAAAGTAGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012157
VALIDATED
FBXL2 MISSION shRNA shRNA Plasmid DNA
F-box and leucine-rich repeat protein 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000004276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012157.x-398s1c1
Sequence:CCGGGAACCTCAATGGATGCACAAACTCGAGTTTGTGCATCCATTGAGGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012157.x-965s1c1
Sequence:CCGGGATAACCGACAGCACACTCATCTCGAGATGAGTGTGCTGTCGGTTATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004279    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012157.x-1748s1c1
Sequence:CCGGTGGCCTACTTTAATTCACAATCTCGAGATTGTGAATTAAAGTAGGCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012157.x-494s1c1
Sequence:CCGGGTCTATTACAAACAGCTCCTTCTCGAGAAGGAGCTGTTTGTAATAGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012157.x-990s1c1
Sequence:CCGGCTCTCCATTCACTGTCCTAAACTCGAGTTTAGGACAGTGAATGGAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012157.2-398s21c1
Sequence:CCGGGAACCTCAATGGATGCACAAACTCGAGTTTGTGCATCCATTGAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012157.2-915s21c1
Sequence:CCGGGCTCGGAATTGCCACGAATTGCTCGAGCAATTCGTGGCAATTCCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012157.2-990s21c1
Sequence:CCGGCTCTCCATTCACTGTCCTAAACTCGAGTTTAGGACAGTGAATGGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279840    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012157.2-1748s21c1
Sequence:CCGGTGGCCTACTTTAATTCACAATCTCGAGATTGTGAATTAAAGTAGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012157
VALIDATED
FBXL2 MISSION shRNA Lentiviral Transduction Particles
F-box and leucine-rich repeat protein 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000004276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012157.x-398s1c1
Sequence:CCGGGAACCTCAATGGATGCACAAACTCGAGTTTGTGCATCCATTGAGGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012157.x-965s1c1
Sequence:CCGGGATAACCGACAGCACACTCATCTCGAGATGAGTGTGCTGTCGGTTATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004279    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012157.x-1748s1c1
Sequence:CCGGTGGCCTACTTTAATTCACAATCTCGAGATTGTGAATTAAAGTAGGCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012157.x-494s1c1
Sequence:CCGGGTCTATTACAAACAGCTCCTTCTCGAGAAGGAGCTGTTTGTAATAGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012157.x-990s1c1
Sequence:CCGGCTCTCCATTCACTGTCCTAAACTCGAGTTTAGGACAGTGAATGGAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012157.2-398s21c1
Sequence:CCGGGAACCTCAATGGATGCACAAACTCGAGTTTGTGCATCCATTGAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012157.2-915s21c1
Sequence:CCGGGCTCGGAATTGCCACGAATTGCTCGAGCAATTCGTGGCAATTCCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012157.2-990s21c1
Sequence:CCGGCTCTCCATTCACTGTCCTAAACTCGAGTTTAGGACAGTGAATGGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279840    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012157.2-1748s21c1
Sequence:CCGGTGGCCTACTTTAATTCACAATCTCGAGATTGTGAATTAAAGTAGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178624
FBXL2 MISSION shRNA Bacterial Glycerol Stock
F-box and leucine-rich repeat protein 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000092668    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178624.2-2392s1c1
Sequence:CCGGCCCAACCACAACTGCAAGAAACTCGAGTTTCTTGCAGTTGTGGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178624.2-364s1c1
Sequence:CCGGGCCGGAACATTGAACATTTAACTCGAGTTAAATGTTCAATGTTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178624.2-428s1c1
Sequence:CCGGCCTTAGCAGATTCTGTTCCAACTCGAGTTGGAACAGAATCTGCTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178624.2-558s1c1
Sequence:CCGGCAGATCACAAAGGAAGGCATTCTCGAGAATGCCTTCCTTTGTGATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178624.2-932s1c1
Sequence:CCGGCCTTGAAGAATGTGTCCTGATCTCGAGATCAGGACACATTCTTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000443607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178624.6-890s21c1
Sequence:CCGGTACACTGCTAGCTCGGAATTGCTCGAGCAATTCCGAGCTAGCAGTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178624.6-405s21c1
Sequence:CCGGATCACTGACAGCACGTGTTACCTCGAGGTAACACGTGCTGTCAGTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424391    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178624.6-1461s21c1
Sequence:CCGGTGGTAATGCTATTCACCTTAACTCGAGTTAAGGTGAATAGCATTACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178624
FBXL2 MISSION shRNA shRNA Plasmid DNA
F-box and leucine-rich repeat protein 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000092668    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178624.2-2392s1c1
Sequence:CCGGCCCAACCACAACTGCAAGAAACTCGAGTTTCTTGCAGTTGTGGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178624.2-364s1c1
Sequence:CCGGGCCGGAACATTGAACATTTAACTCGAGTTAAATGTTCAATGTTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178624.2-428s1c1
Sequence:CCGGCCTTAGCAGATTCTGTTCCAACTCGAGTTGGAACAGAATCTGCTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178624.2-558s1c1
Sequence:CCGGCAGATCACAAAGGAAGGCATTCTCGAGAATGCCTTCCTTTGTGATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178624.2-932s1c1
Sequence:CCGGCCTTGAAGAATGTGTCCTGATCTCGAGATCAGGACACATTCTTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000443607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178624.6-890s21c1
Sequence:CCGGTACACTGCTAGCTCGGAATTGCTCGAGCAATTCCGAGCTAGCAGTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178624.6-405s21c1
Sequence:CCGGATCACTGACAGCACGTGTTACCTCGAGGTAACACGTGCTGTCAGTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424391    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178624.6-1461s21c1
Sequence:CCGGTGGTAATGCTATTCACCTTAACTCGAGTTAAGGTGAATAGCATTACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178624
FBXL2 MISSION shRNA Lentiviral Transduction Particles
F-box and leucine-rich repeat protein 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000092668    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178624.2-2392s1c1
Sequence:CCGGCCCAACCACAACTGCAAGAAACTCGAGTTTCTTGCAGTTGTGGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178624.2-364s1c1
Sequence:CCGGGCCGGAACATTGAACATTTAACTCGAGTTAAATGTTCAATGTTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178624.2-428s1c1
Sequence:CCGGCCTTAGCAGATTCTGTTCCAACTCGAGTTGGAACAGAATCTGCTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178624.2-558s1c1
Sequence:CCGGCAGATCACAAAGGAAGGCATTCTCGAGAATGCCTTCCTTTGTGATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178624.2-932s1c1
Sequence:CCGGCCTTGAAGAATGTGTCCTGATCTCGAGATCAGGACACATTCTTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000443607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178624.6-890s21c1
Sequence:CCGGTACACTGCTAGCTCGGAATTGCTCGAGCAATTCCGAGCTAGCAGTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178624.6-405s21c1
Sequence:CCGGATCACTGACAGCACGTGTTACCTCGAGGTAACACGTGCTGTCAGTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424391    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178624.6-1461s21c1
Sequence:CCGGTGGTAATGCTATTCACCTTAACTCGAGTTAAGGTGAATAGCATTACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks