EMAIL THIS PAGE TO A FRIEND

FBXL3

F-box and leucine-rich repeat protein 3

172 Gene Product Result for
Synonyms: FBL3 FBL3A FBXL3A
UniProtKB ID: Q9UKT7, B2RB04, Q9P122
Gene ID:
Human(26224) Summary: This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbls class and, in addition to an F-box, contains several tandem leucine-rich repeats and is localized in the nucleus. [provided by RefSeq, Jul 2008]
Mouse(50789) F-box and leucine-rich repeat protein 3
Rat(306129) F-box and leucine-rich repeat protein 3
Zebrafish(564855) F-box and leucine-rich repeat protein 3
domestic cat(101085683) F-box and leucine-rich repeat protein 3
cow(540712) F-box and leucine-rich repeat protein 3
Horse(100052811) F-box and leucine-rich repeat protein 3
dog(485499) F-box and leucine-rich repeat protein 3
chicken(428048) F-box and leucine-rich repeat protein 3
sheep(100169937) F-box and leucine-rich repeat protein 3
Domestic Rabbit(100350003) F-box and leucine-rich repeat protein 3
naked mole-rat(101713565) F-box and leucine-rich repeat protein 3
domestic guinea pig(100730124) F-box and leucine-rich repeat protein 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012158 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012158 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012158 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_015822 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_015822 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_015822 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012158 Rosetta Predictions human pricing
XM_001076775 Rosetta Predictions rat pricing
XM_224478 Rosetta Predictions rat pricing
NM_015822 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012158 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00100770 predicted 1403
2 SASI_Hs01_00100771 predicted 874
3 SASI_Hs01_00100772 predicted 1559
4 SASI_Hs01_00100773 predicted 1512
5 SASI_Hs01_00100774 predicted 1468
6 SASI_Hs01_00100775 predicted 415
7 SASI_Hs01_00100776 predicted 1391
8 SASI_Hs01_00100777 predicted 676
9 SASI_Hs01_00100778 predicted 881
10 SASI_Hs01_00100779 predicted 692
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076775 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00354514 predicted 1382
2 SASI_Rn02_00354515 predicted 506
3 SASI_Rn02_00354516 predicted 1325
4 SASI_Rn02_00354517 predicted 1396
5 SASI_Rn02_00354518 predicted 901
6 SASI_Rn02_00354519 predicted 386
7 SASI_Rn02_00354520 predicted 538
8 SASI_Rn02_00354521 predicted 1433
9 SASI_Rn02_00354522 predicted 401
10 SASI_Rn02_00354523 predicted 968
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_224478 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00382018 predicted 1310
2 SASI_Rn02_00382019 predicted 439
3 SASI_Rn02_00382020 predicted 432
4 SASI_Rn02_00382021 predicted 1258
5 SASI_Rn02_00382022 predicted 1321
6 SASI_Rn02_00382023 predicted 829
7 SASI_Rn02_00382024 predicted 319
8 SASI_Rn02_00382025 predicted 1354
9 SASI_Rn02_00382026 predicted 326
10 SASI_Rn02_00382027 predicted 894
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015822 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00162995 predicted 1681
2 SASI_Mm01_00162997 predicted 534
3 SASI_Mm01_00162998 predicted 641
4 SASI_Mm01_00162999 predicted 1513
5 SASI_Mm02_00323224 predicted 804
6 SASI_Mm01_00163000 predicted 1450
7 SASI_Mm02_00323225 predicted 522
8 SASI_Mm01_00163001 predicted 1701
9 SASI_Mm01_00163002 predicted 1609
10 SASI_Mm01_00163003 predicted 1653
11 SASI_Mm01_00162996 predicted 1479
12 SASI_Mm01_00163004 predicted 607
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012158
VALIDATED
FBXL3 MISSION shRNA Bacterial Glycerol Stock
F-box and leucine-rich repeat protein 3
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000004282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012158.x-359s1c1
Sequence:CCGGCCAAGAAACTGAGGACTACAACTCGAGTTGTAGTCCTCAGTTTCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012158.x-1048s1c1
Sequence:CCGGCGATTAGAACATTTGCGCATTCTCGAGAATGCGCAAATGTTCTAATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004281    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012158.x-1818s1c1
Sequence:CCGGCGGATGTGAAATAACCAGTTACTCGAGTAACTGGTTATTTCACATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012158.x-513s1c1
Sequence:CCGGGCCTGACTTGTGGAGATGTTTCTCGAGAAACATCTCCACAAGTCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012158.x-552s1c1
Sequence:CCGGGCCAGCTACATCTTATTTGAACTCGAGTTCAAATAAGATGTAGCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_012158.2-1030s21c1
Sequence:CCGGCTGATCAGTGTCACGGCTTAACTCGAGTTAAGCCGTGACACTGATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364482    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012158.2-1963s21c1
Sequence:CCGGATATCCAAGAAGTACTAATAGCTCGAGCTATTAGTACTTCTTGGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_012158.2-1529s21c1
Sequence:CCGGCCTATCTCAATTATCCATTATCTCGAGATAATGGATAATTGAGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012158.2-561s21c1
Sequence:CCGGCGCAACTGGAACCAGGTATTTCTCGAGAAATACCTGGTTCCAGTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_012158.2-495s21c1
Sequence:CCGGGACATTATTCTCCAAGTATTTCTCGAGAAATACTTGGAGAATAATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369033    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_012158.2-1857s21c1
Sequence:CCGGAGCAGTCATATCTCCGAATTTCTCGAGAAATTCGGAGATATGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012158
VALIDATED
FBXL3 MISSION shRNA shRNA Plasmid DNA
F-box and leucine-rich repeat protein 3
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000004282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012158.x-359s1c1
Sequence:CCGGCCAAGAAACTGAGGACTACAACTCGAGTTGTAGTCCTCAGTTTCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012158.x-1048s1c1
Sequence:CCGGCGATTAGAACATTTGCGCATTCTCGAGAATGCGCAAATGTTCTAATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004281    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012158.x-1818s1c1
Sequence:CCGGCGGATGTGAAATAACCAGTTACTCGAGTAACTGGTTATTTCACATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012158.x-513s1c1
Sequence:CCGGGCCTGACTTGTGGAGATGTTTCTCGAGAAACATCTCCACAAGTCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012158.x-552s1c1
Sequence:CCGGGCCAGCTACATCTTATTTGAACTCGAGTTCAAATAAGATGTAGCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_012158.2-1030s21c1
Sequence:CCGGCTGATCAGTGTCACGGCTTAACTCGAGTTAAGCCGTGACACTGATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364482    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012158.2-1963s21c1
Sequence:CCGGATATCCAAGAAGTACTAATAGCTCGAGCTATTAGTACTTCTTGGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_012158.2-1529s21c1
Sequence:CCGGCCTATCTCAATTATCCATTATCTCGAGATAATGGATAATTGAGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012158.2-561s21c1
Sequence:CCGGCGCAACTGGAACCAGGTATTTCTCGAGAAATACCTGGTTCCAGTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_012158.2-495s21c1
Sequence:CCGGGACATTATTCTCCAAGTATTTCTCGAGAAATACTTGGAGAATAATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369033    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_012158.2-1857s21c1
Sequence:CCGGAGCAGTCATATCTCCGAATTTCTCGAGAAATTCGGAGATATGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012158
VALIDATED
FBXL3 MISSION shRNA Lentiviral Transduction Particles
F-box and leucine-rich repeat protein 3
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000004282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012158.x-359s1c1
Sequence:CCGGCCAAGAAACTGAGGACTACAACTCGAGTTGTAGTCCTCAGTTTCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012158.x-1048s1c1
Sequence:CCGGCGATTAGAACATTTGCGCATTCTCGAGAATGCGCAAATGTTCTAATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004281    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012158.x-1818s1c1
Sequence:CCGGCGGATGTGAAATAACCAGTTACTCGAGTAACTGGTTATTTCACATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012158.x-513s1c1
Sequence:CCGGGCCTGACTTGTGGAGATGTTTCTCGAGAAACATCTCCACAAGTCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012158.x-552s1c1
Sequence:CCGGGCCAGCTACATCTTATTTGAACTCGAGTTCAAATAAGATGTAGCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_012158.2-1030s21c1
Sequence:CCGGCTGATCAGTGTCACGGCTTAACTCGAGTTAAGCCGTGACACTGATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364482    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012158.2-1963s21c1
Sequence:CCGGATATCCAAGAAGTACTAATAGCTCGAGCTATTAGTACTTCTTGGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_012158.2-1529s21c1
Sequence:CCGGCCTATCTCAATTATCCATTATCTCGAGATAATGGATAATTGAGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012158.2-561s21c1
Sequence:CCGGCGCAACTGGAACCAGGTATTTCTCGAGAAATACCTGGTTCCAGTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_012158.2-495s21c1
Sequence:CCGGGACATTATTCTCCAAGTATTTCTCGAGAAATACTTGGAGAATAATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369033    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_012158.2-1857s21c1
Sequence:CCGGAGCAGTCATATCTCCGAATTTCTCGAGAAATTCGGAGATATGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015822
VALIDATED
FBXL3 MISSION shRNA Bacterial Glycerol Stock
F-box and leucine-rich repeat protein 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000126944    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015822.1-2288s1c1
Sequence:CCGGGCCTTGTGTAACTCTAGGTTTCTCGAGAAACCTAGAGTTACACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015822.1-1047s1c1
Sequence:CCGGGCCCTGAACTACCATTTGCTACTCGAGTAGCAAATGGTAGTTCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015822.1-549s1c1
Sequence:CCGGCGGAATTGGAATCAGGTATTTCTCGAGAAATACCTGATTCCAATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015822.1-1394s1c1
Sequence:CCGGGCCTCTTGATGAAGAGTTAATCTCGAGATTAACTCTTCATCAAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015822.1-548s1c1
Sequence:CCGGCCGGAATTGGAATCAGGTATTCTCGAGAATACCTGATTCCAATTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015822
VALIDATED
FBXL3 MISSION shRNA shRNA Plasmid DNA
F-box and leucine-rich repeat protein 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000126944    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015822.1-2288s1c1
Sequence:CCGGGCCTTGTGTAACTCTAGGTTTCTCGAGAAACCTAGAGTTACACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015822.1-1047s1c1
Sequence:CCGGGCCCTGAACTACCATTTGCTACTCGAGTAGCAAATGGTAGTTCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015822.1-549s1c1
Sequence:CCGGCGGAATTGGAATCAGGTATTTCTCGAGAAATACCTGATTCCAATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015822.1-1394s1c1
Sequence:CCGGGCCTCTTGATGAAGAGTTAATCTCGAGATTAACTCTTCATCAAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015822.1-548s1c1
Sequence:CCGGCCGGAATTGGAATCAGGTATTCTCGAGAATACCTGATTCCAATTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015822
VALIDATED
FBXL3 MISSION shRNA Lentiviral Transduction Particles
F-box and leucine-rich repeat protein 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000126944    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015822.1-2288s1c1
Sequence:CCGGGCCTTGTGTAACTCTAGGTTTCTCGAGAAACCTAGAGTTACACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015822.1-1047s1c1
Sequence:CCGGGCCCTGAACTACCATTTGCTACTCGAGTAGCAAATGGTAGTTCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015822.1-549s1c1
Sequence:CCGGCGGAATTGGAATCAGGTATTTCTCGAGAAATACCTGATTCCAATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015822.1-1394s1c1
Sequence:CCGGGCCTCTTGATGAAGAGTTAATCTCGAGATTAACTCTTCATCAAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015822.1-548s1c1
Sequence:CCGGCCGGAATTGGAATCAGGTATTCTCGAGAATACCTGATTCCAATTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks