EMAIL THIS PAGE TO A FRIEND

FBXL5

F-box and leucine-rich repeat protein 5

143 Gene Product Result for
Synonyms: FBL4 FBL5 FLR1
Gene ID:
Human(26234) Summary: This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbls class and, in addition to an F-box, contains several tandem leucine-rich repeats. Alternatively spliced transcript variants have been described for this locus. [provided by RefSeq, Aug 2010]
Mouse(242960) F-box and leucine-rich repeat protein 5
Rat(305424) F-box and leucine-rich repeat protein 5
sheep(101106171) F-box and leucine-rich repeat protein 5
naked mole-rat(101721236) F-box and leucine-rich repeat protein 5
domestic guinea pig(100730429) F-box and leucine-rich repeat protein 5
Zebrafish(322181) F-box and leucine-rich repeat protein 5
chicken(422829) F-box and leucine-rich repeat protein 5
dog(479085) F-box and leucine-rich repeat protein 5
Horse(100055895) F-box and leucine-rich repeat protein 5
cow(519695) F-box and leucine-rich repeat protein 5
domestic cat(101093685) F-box and leucine-rich repeat protein 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1407300 Anti-FBXL5 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
AV43104 Anti-FBXL5 antibody produced in rabbit IgG fraction of antiserum human, mouse, rabbit, horse, bovine, rat, guinea pig
immunohistochemistry, western blot pricing
SAB2105497 Anti-FBXL5 antibody produced in rabbit affinity isolated antibody horse, rabbit, human, guinea pig
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012161 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012161 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012161 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178729 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178729 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178729 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU029531 MISSION® esiRNA esiRNA human FBXL5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012161 Rosetta Predictions human pricing
NM_033535 Rosetta Predictions human pricing
NM_001107222 Rosetta Predictions rat pricing
NM_178729 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012161 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00086630 predicted 1982
2 SASI_Hs01_00086631 predicted 1727
3 SASI_Hs01_00086632 predicted 1003
4 SASI_Hs02_00343752 predicted 1788
5 SASI_Hs01_00086633 predicted 691
6 SASI_Hs01_00086634 predicted 865
7 SASI_Hs01_00086635 predicted 615
8 SASI_Hs01_00086636 predicted 969
9 SASI_Hs01_00086637 predicted 2242
10 SASI_Hs01_00086638 predicted 881
11 SASI_Hs01_00086639 predicted 1981
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033535 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00027206 predicted 2091
2 SASI_Hs01_00027207 predicted 1831
3 SASI_Hs02_00361410 predicted 1104
4 SASI_Hs01_00027208 predicted 794
5 SASI_Hs01_00027209 predicted 972
6 SASI_Hs01_00027210 predicted 1261
7 SASI_Hs01_00027211 predicted 724
8 SASI_Hs01_00027212 predicted 2344
9 SASI_Hs01_00027213 predicted 700
10 SASI_Hs01_00027215 predicted 986
11 SASI_Hs01_00027214 predicted 1293
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107222 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00226715 predicted 500
2 SASI_Rn02_00226716 predicted 1452
3 SASI_Rn02_00226717 predicted 1224
4 SASI_Rn02_00226718 predicted 1745
5 SASI_Rn02_00226719 predicted 894
6 SASI_Rn02_00226720 predicted 1998
7 SASI_Rn02_00226721 predicted 1325
8 SASI_Rn02_00226722 predicted 579
9 SASI_Rn02_00226723 predicted 1832
10 SASI_Rn02_00226724 predicted 242
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178729 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00128089 predicted 723
2 SASI_Mm01_00128090 predicted 1491
3 SASI_Mm01_00128091 predicted 1571
4 SASI_Mm01_00128092 predicted 1622
5 SASI_Mm01_00128093 predicted 347
6 SASI_Mm02_00349259 predicted 1694
7 SASI_Mm01_00128095 predicted 1127
8 SASI_Mm01_00128096 predicted 637
9 SASI_Mm01_00128097 predicted 918
10 SASI_Mm01_00128098 predicted 2002
11 SASI_Mm01_00128094 predicted 1464
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012161
VALIDATED
FBXL5 MISSION shRNA Bacterial Glycerol Stock
F-box and leucine-rich repeat protein 5
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000004290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012161.x-911s1c1
Sequence:CCGGCCTGATGATGAATGGGTGAAACTCGAGTTTCACCCATTCATCATCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012161.x-1553s1c1
Sequence:CCGGGCTGAAGATTTGGCTGATATTCTCGAGAATATCAGCCAAATCTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012161.x-1758s1c1
Sequence:CCGGGTACAGGAACAGCTTTAAGAACTCGAGTTCTTAAAGCTGTTCCTGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012161.x-697s1c1
Sequence:CCGGGTCAGAACACTCCACAGGTATCTCGAGATACCTGTGGAGTGTTCTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004293    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012161.x-2234s1c1
Sequence:CCGGGCACTTTACTCATAGCACATTCTCGAGAATGTGCTATGAGTAAAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012161.2-1553s21c1
Sequence:CCGGGCTGAAGATTTGGCTGATATTCTCGAGAATATCAGCCAAATCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281896    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012161.2-2234s21c1
Sequence:CCGGGCACTTTACTCATAGCACATTCTCGAGAATGTGCTATGAGTAAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012161.2-911s21c1
Sequence:CCGGCCTGATGATGAATGGGTGAAACTCGAGTTTCACCCATTCATCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012161.2-314s21c1
Sequence:CCGGCAACGCAGCCAGACCATTTATCTCGAGATAAATGGTCTGGCTGCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012161.2-1434s21c1
Sequence:CCGGATGCCTGTTTGCACGATTTAACTCGAGTTAAATCGTGCAAACAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012161
VALIDATED
FBXL5 MISSION shRNA shRNA Plasmid DNA
F-box and leucine-rich repeat protein 5
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000004290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012161.x-911s1c1
Sequence:CCGGCCTGATGATGAATGGGTGAAACTCGAGTTTCACCCATTCATCATCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012161.x-1553s1c1
Sequence:CCGGGCTGAAGATTTGGCTGATATTCTCGAGAATATCAGCCAAATCTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012161.x-1758s1c1
Sequence:CCGGGTACAGGAACAGCTTTAAGAACTCGAGTTCTTAAAGCTGTTCCTGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012161.x-697s1c1
Sequence:CCGGGTCAGAACACTCCACAGGTATCTCGAGATACCTGTGGAGTGTTCTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004293    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012161.x-2234s1c1
Sequence:CCGGGCACTTTACTCATAGCACATTCTCGAGAATGTGCTATGAGTAAAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012161.2-1553s21c1
Sequence:CCGGGCTGAAGATTTGGCTGATATTCTCGAGAATATCAGCCAAATCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281896    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012161.2-2234s21c1
Sequence:CCGGGCACTTTACTCATAGCACATTCTCGAGAATGTGCTATGAGTAAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012161.2-911s21c1
Sequence:CCGGCCTGATGATGAATGGGTGAAACTCGAGTTTCACCCATTCATCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012161.2-314s21c1
Sequence:CCGGCAACGCAGCCAGACCATTTATCTCGAGATAAATGGTCTGGCTGCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012161.2-1434s21c1
Sequence:CCGGATGCCTGTTTGCACGATTTAACTCGAGTTAAATCGTGCAAACAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012161
VALIDATED
FBXL5 MISSION shRNA Lentiviral Transduction Particles
F-box and leucine-rich repeat protein 5
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000004290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012161.x-911s1c1
Sequence:CCGGCCTGATGATGAATGGGTGAAACTCGAGTTTCACCCATTCATCATCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012161.x-1553s1c1
Sequence:CCGGGCTGAAGATTTGGCTGATATTCTCGAGAATATCAGCCAAATCTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012161.x-1758s1c1
Sequence:CCGGGTACAGGAACAGCTTTAAGAACTCGAGTTCTTAAAGCTGTTCCTGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012161.x-697s1c1
Sequence:CCGGGTCAGAACACTCCACAGGTATCTCGAGATACCTGTGGAGTGTTCTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004293    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012161.x-2234s1c1
Sequence:CCGGGCACTTTACTCATAGCACATTCTCGAGAATGTGCTATGAGTAAAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012161.2-1553s21c1
Sequence:CCGGGCTGAAGATTTGGCTGATATTCTCGAGAATATCAGCCAAATCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281896    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012161.2-2234s21c1
Sequence:CCGGGCACTTTACTCATAGCACATTCTCGAGAATGTGCTATGAGTAAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012161.2-911s21c1
Sequence:CCGGCCTGATGATGAATGGGTGAAACTCGAGTTTCACCCATTCATCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012161.2-314s21c1
Sequence:CCGGCAACGCAGCCAGACCATTTATCTCGAGATAAATGGTCTGGCTGCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012161.2-1434s21c1
Sequence:CCGGATGCCTGTTTGCACGATTTAACTCGAGTTAAATCGTGCAAACAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178729
VALIDATED
FBXL5 MISSION shRNA Bacterial Glycerol Stock
F-box and leucine-rich repeat protein 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178729.3-1133s21c1
Sequence:CCGGATCTTACCCAGACCGACATTTCTCGAGAAATGTCGGTCTGGGTAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249855    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178729.3-2260s21c1
Sequence:CCGGATACCGTGAAGTACCTATAAACTCGAGTTTATAGGTACTTCACGGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178729.3-911s21c1
Sequence:CCGGGGGATGAAGATGCCGATATAGCTCGAGCTATATCGGCATCTTCATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178729.3-259s21c1
Sequence:CCGGCAGCGCAGTCAGACCATATATCTCGAGATATATGGTCTGACTGCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178729.3-730s21c1
Sequence:CCGGTGTAGTCAAGTCAGTACTAAGCTCGAGCTTAGTACTGACTTGACTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178729
VALIDATED
FBXL5 MISSION shRNA shRNA Plasmid DNA
F-box and leucine-rich repeat protein 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178729.3-1133s21c1
Sequence:CCGGATCTTACCCAGACCGACATTTCTCGAGAAATGTCGGTCTGGGTAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249855    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178729.3-2260s21c1
Sequence:CCGGATACCGTGAAGTACCTATAAACTCGAGTTTATAGGTACTTCACGGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178729.3-911s21c1
Sequence:CCGGGGGATGAAGATGCCGATATAGCTCGAGCTATATCGGCATCTTCATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178729.3-259s21c1
Sequence:CCGGCAGCGCAGTCAGACCATATATCTCGAGATATATGGTCTGACTGCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178729.3-730s21c1
Sequence:CCGGTGTAGTCAAGTCAGTACTAAGCTCGAGCTTAGTACTGACTTGACTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178729
VALIDATED
FBXL5 MISSION shRNA Lentiviral Transduction Particles
F-box and leucine-rich repeat protein 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178729.3-1133s21c1
Sequence:CCGGATCTTACCCAGACCGACATTTCTCGAGAAATGTCGGTCTGGGTAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249855    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178729.3-2260s21c1
Sequence:CCGGATACCGTGAAGTACCTATAAACTCGAGTTTATAGGTACTTCACGGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178729.3-911s21c1
Sequence:CCGGGGGATGAAGATGCCGATATAGCTCGAGCTATATCGGCATCTTCATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178729.3-259s21c1
Sequence:CCGGCAGCGCAGTCAGACCATATATCTCGAGATATATGGTCTGACTGCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178729.3-730s21c1
Sequence:CCGGTGTAGTCAAGTCAGTACTAAGCTCGAGCTTAGTACTGACTTGACTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks