EMAIL THIS PAGE TO A FRIEND

FBXL6

F-box and leucine-rich repeat protein 6

69 Gene Product Result for
Synonyms: FBL6 FBL6A PP14630
UniProtKB ID: Q8N531, Q53G43, Q9H5W9, Q9UKC7
Gene ID:
Human(26233) Summary: This gene encodes a member of a family of proteins that are characterized by an F-box motif. The encoded protein also contains leucine-rich repeats. F-box-containing proteins comprise one of the subunits of the SCF (SKP1-cullin-F-box) complex, which functions in phosphorylation-dependent ubiquitination. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Mouse(30840) F-box and leucine-rich repeat protein 6
Rat(362941) F-box and leucine-rich repeat protein 6
Zebrafish(323163) F-box and leucine-rich repeat protein 6
cow(512690) F-box and leucine-rich repeat protein 6
Horse(100147644) F-box and leucine-rich repeat protein 6
domestic cat(101096205) F-box and leucine-rich repeat protein 6
dog(482094) F-box and leucine-rich repeat protein 6
domestic guinea pig(100734128) F-box and leucine-rich repeat protein 6
naked mole-rat(101722250) F-box and leucine-rich repeat protein 6
sheep(101108580) F-box and leucine-rich repeat protein 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012162 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012162 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012162 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013909 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013909 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013909 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012162 Rosetta Predictions human pricing
NM_024555 Rosetta Predictions human pricing
NM_001005563 Rosetta Predictions rat pricing
NM_013909 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012162 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00115630 predicted 1114
2 SASI_Hs02_00343753 predicted 1481
3 SASI_Hs01_00115633 predicted 1125
4 SASI_Hs02_00343754 predicted 1475
5 SASI_Hs01_00115634 predicted 1167
6 SASI_Hs02_00343755 predicted 1275
7 SASI_Hs01_00115636 predicted 1168
8 SASI_Hs01_00115637 predicted 1120
9 SASI_Hs01_00115638 predicted 1350
10 SASI_Hs02_00343756 predicted 1176
11 SASI_Hs01_00115629 predicted 1277
12 SASI_Hs01_00115631 predicted 1337
13 SASI_Hs01_00115632 predicted 947
14 SASI_Hs01_00115635 predicted 1490
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024555 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00192065 predicted 1098
2 SASI_Hs02_00356860 predicted 1469
3 SASI_Hs01_00192068 predicted 1107
4 SASI_Hs02_00356861 predicted 1461
5 SASI_Hs01_00192069 predicted 1147
6 SASI_Hs02_00356862 predicted 1261
7 SASI_Hs01_00192071 predicted 1156
8 SASI_Hs01_00192072 predicted 1107
9 SASI_Hs01_00192073 predicted 1328
10 SASI_Hs02_00356863 predicted 1152
11 SASI_Hs01_00192064 predicted 1257
12 SASI_Hs01_00192066 predicted 1320
13 SASI_Hs01_00192067 predicted 934
14 SASI_Hs01_00192070 predicted 1471
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005563 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00198426 predicted 1408
2 SASI_Rn01_00120205 predicted 1085
3 SASI_Rn01_00120206 predicted 334
4 SASI_Rn01_00120207 predicted 686
5 SASI_Rn02_00198427 predicted 1184
6 SASI_Rn01_00120208 predicted 495
7 SASI_Rn02_00198428 predicted 1149
8 SASI_Rn01_00120209 predicted 1280
9 SASI_Rn01_00120211 predicted 332
10 SASI_Rn01_00120212 predicted 1450
11 SASI_Rn01_00120210 predicted 745
12 SASI_Rn01_00120213 predicted 363
13 SASI_Rn01_00120214 predicted 1195
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013909 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00322996 predicted 1450
2 SASI_Mm02_00322997 predicted 690
3 SASI_Mm02_00322998 predicted 1088
4 SASI_Mm02_00322999 predicted 374
5 SASI_Mm02_00323000 predicted 648
6 SASI_Mm02_00323001 predicted 1099
7 SASI_Mm02_00323002 predicted 437
8 SASI_Mm02_00323003 predicted 496
9 SASI_Mm02_00323004 predicted 335
10 SASI_Mm02_00323005 predicted 1060
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012162
FBXL6 MISSION shRNA Bacterial Glycerol Stock
F-box and leucine-rich repeat protein 6
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012162.1-361s21c1
Sequence:CCGGAGACCGCATTCCCTTGGAAATCTCGAGATTTCCAAGGGAATGCGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012162.1-943s21c1
Sequence:CCGGCACCGGCATCAACCGTAATAGCTCGAGCTATTACGGTTGATGCCGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012162.1-579s21c1
Sequence:CCGGTGGAGTGGCTTATGCCCAATCCTCGAGGATTGGGCATAAGCCACTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012162.x-682s1c1
Sequence:CCGGTCCTCGGCTCACTTTCCTCAACTCGAGTTGAGGAAAGTGAGCCGAGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012162.x-1446s1c1
Sequence:CCGGCCCTGTGCTCTCTTAACCTCACTCGAGTGAGGTTAAGAGAGCACAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012162.x-1032s1c1
Sequence:CCGGTGAACCTGATGTGGCTGCCCACTCGAGTGGGCAGCCACATCAGGTTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012162.x-1181s1c1
Sequence:CCGGCTGCGCTTACTGGATCTTCGTCTCGAGACGAAGATCCAGTAAGCGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012162.x-1347s1c1
Sequence:CCGGCACTGCGAGAACTGGACTTGACTCGAGTCAAGTCCAGTTCTCGCAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012162
FBXL6 MISSION shRNA shRNA Plasmid DNA
F-box and leucine-rich repeat protein 6
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012162.1-361s21c1
Sequence:CCGGAGACCGCATTCCCTTGGAAATCTCGAGATTTCCAAGGGAATGCGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012162.1-943s21c1
Sequence:CCGGCACCGGCATCAACCGTAATAGCTCGAGCTATTACGGTTGATGCCGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012162.1-579s21c1
Sequence:CCGGTGGAGTGGCTTATGCCCAATCCTCGAGGATTGGGCATAAGCCACTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012162.x-682s1c1
Sequence:CCGGTCCTCGGCTCACTTTCCTCAACTCGAGTTGAGGAAAGTGAGCCGAGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012162.x-1446s1c1
Sequence:CCGGCCCTGTGCTCTCTTAACCTCACTCGAGTGAGGTTAAGAGAGCACAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012162.x-1032s1c1
Sequence:CCGGTGAACCTGATGTGGCTGCCCACTCGAGTGGGCAGCCACATCAGGTTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012162.x-1181s1c1
Sequence:CCGGCTGCGCTTACTGGATCTTCGTCTCGAGACGAAGATCCAGTAAGCGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012162.x-1347s1c1
Sequence:CCGGCACTGCGAGAACTGGACTTGACTCGAGTCAAGTCCAGTTCTCGCAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012162
FBXL6 MISSION shRNA Lentiviral Transduction Particles
F-box and leucine-rich repeat protein 6
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012162.1-361s21c1
Sequence:CCGGAGACCGCATTCCCTTGGAAATCTCGAGATTTCCAAGGGAATGCGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012162.1-943s21c1
Sequence:CCGGCACCGGCATCAACCGTAATAGCTCGAGCTATTACGGTTGATGCCGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012162.1-579s21c1
Sequence:CCGGTGGAGTGGCTTATGCCCAATCCTCGAGGATTGGGCATAAGCCACTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012162.x-682s1c1
Sequence:CCGGTCCTCGGCTCACTTTCCTCAACTCGAGTTGAGGAAAGTGAGCCGAGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012162.x-1446s1c1
Sequence:CCGGCCCTGTGCTCTCTTAACCTCACTCGAGTGAGGTTAAGAGAGCACAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012162.x-1032s1c1
Sequence:CCGGTGAACCTGATGTGGCTGCCCACTCGAGTGGGCAGCCACATCAGGTTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012162.x-1181s1c1
Sequence:CCGGCTGCGCTTACTGGATCTTCGTCTCGAGACGAAGATCCAGTAAGCGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012162.x-1347s1c1
Sequence:CCGGCACTGCGAGAACTGGACTTGACTCGAGTCAAGTCCAGTTCTCGCAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013909
VALIDATED
FBXL6 MISSION shRNA Bacterial Glycerol Stock
F-box and leucine-rich repeat protein 6
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000277488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013909.1-744s21c1
Sequence:CCGGCCTGGACCTACATCATTCCATCTCGAGATGGAATGATGTAGGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013909.1-1235s21c1
Sequence:CCGGACCTGGGCCTGTATGGCATATCTCGAGATATGCCATACAGGCCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013909.1-341s21c1
Sequence:CCGGCCTTAGAAGTCCTGGTGCATACTCGAGTATGCACCAGGACTTCTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013909.1-693s21c1
Sequence:CCGGGACTGCTGAAACTCTGGTCATCTCGAGATGACCAGAGTTTCAGCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013909.1-992s21c1
Sequence:CCGGTGCGGCTGCTGAATCTGATTTCTCGAGAAATCAGATTCAGCAGCCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013909.1-693s1c1
Sequence:CCGGGACTGCTGAAACTCTGGTCATCTCGAGATGACCAGAGTTTCAGCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013909.1-341s1c1
Sequence:CCGGCCTTAGAAGTCCTGGTGCATACTCGAGTATGCACCAGGACTTCTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013909.1-744s1c1
Sequence:CCGGCCTGGACCTACATCATTCCATCTCGAGATGGAATGATGTAGGTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013909.1-697s1c1
Sequence:CCGGGCTGAAACTCTGGTCATGTTACTCGAGTAACATGACCAGAGTTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013909
VALIDATED
FBXL6 MISSION shRNA shRNA Plasmid DNA
F-box and leucine-rich repeat protein 6
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000277488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013909.1-744s21c1
Sequence:CCGGCCTGGACCTACATCATTCCATCTCGAGATGGAATGATGTAGGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013909.1-1235s21c1
Sequence:CCGGACCTGGGCCTGTATGGCATATCTCGAGATATGCCATACAGGCCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013909.1-341s21c1
Sequence:CCGGCCTTAGAAGTCCTGGTGCATACTCGAGTATGCACCAGGACTTCTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013909.1-693s21c1
Sequence:CCGGGACTGCTGAAACTCTGGTCATCTCGAGATGACCAGAGTTTCAGCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013909.1-992s21c1
Sequence:CCGGTGCGGCTGCTGAATCTGATTTCTCGAGAAATCAGATTCAGCAGCCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013909.1-693s1c1
Sequence:CCGGGACTGCTGAAACTCTGGTCATCTCGAGATGACCAGAGTTTCAGCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013909.1-341s1c1
Sequence:CCGGCCTTAGAAGTCCTGGTGCATACTCGAGTATGCACCAGGACTTCTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013909.1-744s1c1
Sequence:CCGGCCTGGACCTACATCATTCCATCTCGAGATGGAATGATGTAGGTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013909.1-697s1c1
Sequence:CCGGGCTGAAACTCTGGTCATGTTACTCGAGTAACATGACCAGAGTTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013909
VALIDATED
FBXL6 MISSION shRNA Lentiviral Transduction Particles
F-box and leucine-rich repeat protein 6
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000277488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013909.1-744s21c1
Sequence:CCGGCCTGGACCTACATCATTCCATCTCGAGATGGAATGATGTAGGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013909.1-1235s21c1
Sequence:CCGGACCTGGGCCTGTATGGCATATCTCGAGATATGCCATACAGGCCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013909.1-341s21c1
Sequence:CCGGCCTTAGAAGTCCTGGTGCATACTCGAGTATGCACCAGGACTTCTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013909.1-693s21c1
Sequence:CCGGGACTGCTGAAACTCTGGTCATCTCGAGATGACCAGAGTTTCAGCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013909.1-992s21c1
Sequence:CCGGTGCGGCTGCTGAATCTGATTTCTCGAGAAATCAGATTCAGCAGCCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013909.1-693s1c1
Sequence:CCGGGACTGCTGAAACTCTGGTCATCTCGAGATGACCAGAGTTTCAGCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013909.1-341s1c1
Sequence:CCGGCCTTAGAAGTCCTGGTGCATACTCGAGTATGCACCAGGACTTCTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013909.1-744s1c1
Sequence:CCGGCCTGGACCTACATCATTCCATCTCGAGATGGAATGATGTAGGTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013909.1-697s1c1
Sequence:CCGGGCTGAAACTCTGGTCATGTTACTCGAGTAACATGACCAGAGTTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks