EMAIL THIS PAGE TO A FRIEND

FBXL7

F-box and leucine-rich repeat protein 7

159 Gene Product Result for
Synonyms: FBL6 FBL7
UniProtKB ID: Q9UJT9, B9EGF1, O94926
Gene ID:
Human(23194) Summary: This gene encodes a member of the F-box protein family which is characterized by a 42-48 amino acid motif, the F-box, which binds to the S-phase kinase-associated protein 1 (Skp1) protein. The F-box proteins constitute one of the four subunits of E3 ubiquitin protein ligases called SCFs (SKP1-Cul1-F-box), which play a role in phosphorylation-dependent ubiquitination of proteins. The F-box proteins are divided into 3 subfamilies based on the other domain in the protein: F-box proteins that also have a WD-40 domain (Fbws subfamily), F-box proteins that also have leucine-rich repeats (Fbls subfamily) and F-box proteins that contain other motifs or lack known protein-interaction domains (Fbxs subfamily). The protein encoded by this gene belongs to the Fbls subfamily. Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, May 2013]
Mouse(448987) F-box and leucine-rich repeat protein 7
Rat(361907) F-box and leucine-rich repeat protein 7
sheep(101102932) F-box and leucine-rich repeat protein 7
naked mole-rat(101700886) F-box and leucine-rich repeat protein 7
domestic guinea pig(100720048) F-box and leucine-rich repeat protein 7
chicken(428492) F-box and leucine-rich repeat protein 7
domestic cat(101089921) F-box and leucine-rich repeat protein 7
cow(518806) F-box and leucine-rich repeat protein 7
Horse(100070113) F-box and leucine-rich repeat protein 7
dog(489262) F-box and leucine-rich repeat protein 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_176959 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_176959 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_176959 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_012304 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012304 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012304 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012304 Rosetta Predictions human pricing
NM_001108545 Rosetta Predictions rat pricing
NM_176959 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012304 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00128431 predicted 482
2 SASI_Hs01_00128432 predicted 1963
3 SASI_Hs01_00128433 predicted 527
4 SASI_Hs01_00128434 predicted 1025
5 SASI_Hs01_00128435 predicted 656
6 SASI_Hs01_00128437 predicted 1431
7 SASI_Hs01_00128439 predicted 1832
8 SASI_Hs01_00128440 predicted 649
9 SASI_Hs02_00344075 predicted 1685
10 SASI_Hs02_00344076 predicted 1673
11 SASI_Hs01_00128436 predicted 1147
12 SASI_Hs01_00128438 predicted 1712
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108545 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00239699 predicted 465
2 SASI_Rn02_00239700 predicted 1571
3 SASI_Rn02_00239701 predicted 1271
4 SASI_Rn02_00239702 predicted 1417
5 SASI_Rn02_00239703 predicted 779
6 SASI_Rn02_00239704 predicted 1118
7 SASI_Rn02_00239705 predicted 1562
8 SASI_Rn02_00239706 predicted 1471
9 SASI_Rn02_00239707 predicted 1571
10 SASI_Rn02_00239708 predicted 1725
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176959 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00084984 predicted 522
2 SASI_Mm02_00346861 predicted 1614
3 SASI_Mm01_00084985 predicted 697
4 SASI_Mm01_00084986 predicted 2012
5 SASI_Mm01_00084987 predicted 680
6 SASI_Mm01_00084988 predicted 2057
7 SASI_Mm01_00084989 predicted 1522
8 SASI_Mm01_00084990 predicted 1171
9 SASI_Mm01_00084991 predicted 619
10 SASI_Mm01_00084992 predicted 1781
11 SASI_Mm01_00084993 predicted 1455
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_176959
FBXL7 MISSION shRNA Bacterial Glycerol Stock
F-box and leucine-rich repeat protein 7
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000087608    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176959.3-2368s1c1
Sequence:CCGGGCGTTGAAGAAGGCTCTCTAACTCGAGTTAGAGAGCCTTCTTCAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176959.3-1321s1c1
Sequence:CCGGGCAAACAGATTTCCATCCGATCTCGAGATCGGATGGAAATCTGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176959.3-696s1c1
Sequence:CCGGCCACCGACTTTGCCAGGATTTCTCGAGAAATCCTGGCAAAGTCGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176959.3-1343s1c1
Sequence:CCGGCCTTGATATGACGGACTGCTTCTCGAGAAGCAGTCCGTCATATCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176959.3-1615s1c1
Sequence:CCGGGCATTCGTTATGTGGCTAAATCTCGAGATTTAGCCACATAACGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_176959
FBXL7 MISSION shRNA shRNA Plasmid DNA
F-box and leucine-rich repeat protein 7
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000087608    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176959.3-2368s1c1
Sequence:CCGGGCGTTGAAGAAGGCTCTCTAACTCGAGTTAGAGAGCCTTCTTCAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176959.3-1321s1c1
Sequence:CCGGGCAAACAGATTTCCATCCGATCTCGAGATCGGATGGAAATCTGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176959.3-696s1c1
Sequence:CCGGCCACCGACTTTGCCAGGATTTCTCGAGAAATCCTGGCAAAGTCGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176959.3-1343s1c1
Sequence:CCGGCCTTGATATGACGGACTGCTTCTCGAGAAGCAGTCCGTCATATCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176959.3-1615s1c1
Sequence:CCGGGCATTCGTTATGTGGCTAAATCTCGAGATTTAGCCACATAACGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_176959
FBXL7 MISSION shRNA Lentiviral Transduction Particles
F-box and leucine-rich repeat protein 7
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000087608    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176959.3-2368s1c1
Sequence:CCGGGCGTTGAAGAAGGCTCTCTAACTCGAGTTAGAGAGCCTTCTTCAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176959.3-1321s1c1
Sequence:CCGGGCAAACAGATTTCCATCCGATCTCGAGATCGGATGGAAATCTGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176959.3-696s1c1
Sequence:CCGGCCACCGACTTTGCCAGGATTTCTCGAGAAATCCTGGCAAAGTCGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176959.3-1343s1c1
Sequence:CCGGCCTTGATATGACGGACTGCTTCTCGAGAAGCAGTCCGTCATATCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176959.3-1615s1c1
Sequence:CCGGGCATTCGTTATGTGGCTAAATCTCGAGATTTAGCCACATAACGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012304
FBXL7 MISSION shRNA Bacterial Glycerol Stock
F-box and leucine-rich repeat protein 7
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000118322    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012304.3-1973s1c1
Sequence:CCGGCCGGCGTTGTATTCACACAAACTCGAGTTTGTGTGAATACAACGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012304.3-662s1c1
Sequence:CCGGCCACCGAATCTCCCAGGATTTCTCGAGAAATCCTGGGAGATTCGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012304.3-1897s1c1
Sequence:CCGGCTTTGTCAAACGCCACTGCAACTCGAGTTGCAGTGGCGTTTGACAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012304.3-1277s1c1
Sequence:CCGGCCCTTGCATGGCAAACAGATTCTCGAGAATCTGTTTGCCATGCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012304.3-534s1c1
Sequence:CCGGGCATCTCATCTGACGTGAGTTCTCGAGAACTCACGTCAGATGAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012304
FBXL7 MISSION shRNA shRNA Plasmid DNA
F-box and leucine-rich repeat protein 7
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000118322    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012304.3-1973s1c1
Sequence:CCGGCCGGCGTTGTATTCACACAAACTCGAGTTTGTGTGAATACAACGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012304.3-662s1c1
Sequence:CCGGCCACCGAATCTCCCAGGATTTCTCGAGAAATCCTGGGAGATTCGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012304.3-1897s1c1
Sequence:CCGGCTTTGTCAAACGCCACTGCAACTCGAGTTGCAGTGGCGTTTGACAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012304.3-1277s1c1
Sequence:CCGGCCCTTGCATGGCAAACAGATTCTCGAGAATCTGTTTGCCATGCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012304.3-534s1c1
Sequence:CCGGGCATCTCATCTGACGTGAGTTCTCGAGAACTCACGTCAGATGAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012304
FBXL7 MISSION shRNA Lentiviral Transduction Particles
F-box and leucine-rich repeat protein 7
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000118322    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012304.3-1973s1c1
Sequence:CCGGCCGGCGTTGTATTCACACAAACTCGAGTTTGTGTGAATACAACGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012304.3-662s1c1
Sequence:CCGGCCACCGAATCTCCCAGGATTTCTCGAGAAATCCTGGGAGATTCGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012304.3-1897s1c1
Sequence:CCGGCTTTGTCAAACGCCACTGCAACTCGAGTTGCAGTGGCGTTTGACAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012304.3-1277s1c1
Sequence:CCGGCCCTTGCATGGCAAACAGATTCTCGAGAATCTGTTTGCCATGCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012304.3-534s1c1
Sequence:CCGGGCATCTCATCTGACGTGAGTTCTCGAGAACTCACGTCAGATGAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks