EMAIL THIS PAGE TO A FRIEND

FBXL8

F-box and leucine-rich repeat protein 8

51 Gene Product Result for
Synonyms: FBL8
UniProtKB ID: Q96CD0, Q9NUM0
Gene ID:
Human(55336) Summary: This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of the ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbls class. It shares 78% sequence identity with the mouse protein. [provided by RefSeq, Jul 2008]
Mouse(50788) F-box and leucine-rich repeat protein 8
Rat(498941) F-box and leucine-rich repeat protein 8
Zebrafish(641481) F-box and leucine-rich repeat protein 8
cow(614765) F-box and leucine-rich repeat protein 8
chicken(415701) F-box and leucine-rich repeat protein 8
domestic cat(101098022) F-box and leucine-rich repeat protein 8
dog(611261) F-box and leucine-rich repeat protein 8
domestic guinea pig(100713293) F-box and leucine-rich repeat protein 8
naked mole-rat(101720258) F-box and leucine-rich repeat protein 8
sheep(101111735) F-box and leucine-rich repeat protein 8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015821 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_015821 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_015821 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018378 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018378 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018378 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU007211 MISSION® esiRNA esiRNA targeting mouse Fbxl8 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018378 Rosetta Predictions human pricing
NM_001109128 Rosetta Predictions rat pricing
NM_015821 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018378 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00091225 predicted 716
2 SASI_Hs01_00091227 predicted 763
3 SASI_Hs01_00091228 predicted 432
4 SASI_Hs01_00091229 predicted 327
5 SASI_Hs01_00091230 predicted 961
6 SASI_Hs01_00091231 predicted 284
7 SASI_Hs01_00091232 predicted 769
8 SASI_Hs02_00351859 predicted 542
9 SASI_Hs01_00091233 predicted 962
10 SASI_Hs01_00091234 predicted 332
11 SASI_Hs01_00091226 predicted 725
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109128 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00245400 predicted 894
2 SASI_Rn02_00245401 predicted 1413
3 SASI_Rn02_00245402 predicted 937
4 SASI_Rn02_00245403 predicted 1425
5 SASI_Rn02_00245404 predicted 1466
6 SASI_Rn02_00245405 predicted 802
7 SASI_Rn02_00245406 predicted 1577
8 SASI_Rn02_00245407 predicted 798
9 SASI_Rn02_00245408 predicted 934
10 SASI_Rn02_00245409 predicted 908
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015821 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00048433 predicted 380
2 SASI_Mm01_00048434 predicted 890
3 SASI_Mm01_00048435 predicted 1201
4 SASI_Mm01_00048436 predicted 940
5 SASI_Mm02_00323223 predicted 676
6 SASI_Mm01_00048438 predicted 1428
7 SASI_Mm01_00048439 predicted 1430
8 SASI_Mm01_00048440 predicted 781
9 SASI_Mm01_00048441 predicted 1162
10 SASI_Mm01_00048442 predicted 563
11 SASI_Mm01_00048437 predicted 580
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015821
VALIDATED
FBXL8 MISSION shRNA Bacterial Glycerol Stock
F-box and leucine-rich repeat protein 8
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000194550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015821.1-1245s1c1
Sequence:CCGGGCGCCACTACGATGAAACTTTCTCGAGAAAGTTTCATCGTAGTGGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015821.1-564s1c1
Sequence:CCGGCCACATTCACAACCTAAGGCTCTCGAGAGCCTTAGGTTGTGAATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015821.1-571s1c1
Sequence:CCGGCACAACCTAAGGCTGGAATATCTCGAGATATTCCAGCCTTAGGTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015821.1-582s1c1
Sequence:CCGGGCTGGAATATGAGCCATCAAACTCGAGTTTGATGGCTCATATTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_015821.1-526s1c1
Sequence:CCGGGAAGACTTGTTGCCACCATATCTCGAGATATGGTGGCAACAAGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_015821.2-555s21c1
Sequence:CCGGCAGCACCGTGTGGTCTGATAACTCGAGTTATCAGACCACACGGTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366122    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015821.2-1710s21c1
Sequence:CCGGCCAATCTCAGGCACCATAAATCTCGAGATTTATGGTGCCTGAGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015821.2-1021s21c1
Sequence:CCGGGGACTGCACCTTGCTAGTATGCTCGAGCATACTAGCAAGGTGCAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_015821.2-1497s21c1
Sequence:CCGGCAGCTATACGCTCAAGCTAAACTCGAGTTTAGCTTGAGCGTATAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015821.2-1321s21c1
Sequence:CCGGCGCCACTACGCTGAAACTTTGCTCGAGCAAAGTTTCAGCGTAGTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_015821.2-968s21c1
Sequence:CCGGAGCCCACTTCTGTGCTCAAACCTCGAGGTTTGAGCACAGAAGTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015821
VALIDATED
FBXL8 MISSION shRNA shRNA Plasmid DNA
F-box and leucine-rich repeat protein 8
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000194550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015821.1-1245s1c1
Sequence:CCGGGCGCCACTACGATGAAACTTTCTCGAGAAAGTTTCATCGTAGTGGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015821.1-564s1c1
Sequence:CCGGCCACATTCACAACCTAAGGCTCTCGAGAGCCTTAGGTTGTGAATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015821.1-571s1c1
Sequence:CCGGCACAACCTAAGGCTGGAATATCTCGAGATATTCCAGCCTTAGGTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015821.1-582s1c1
Sequence:CCGGGCTGGAATATGAGCCATCAAACTCGAGTTTGATGGCTCATATTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_015821.1-526s1c1
Sequence:CCGGGAAGACTTGTTGCCACCATATCTCGAGATATGGTGGCAACAAGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_015821.2-555s21c1
Sequence:CCGGCAGCACCGTGTGGTCTGATAACTCGAGTTATCAGACCACACGGTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366122    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015821.2-1710s21c1
Sequence:CCGGCCAATCTCAGGCACCATAAATCTCGAGATTTATGGTGCCTGAGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015821.2-1021s21c1
Sequence:CCGGGGACTGCACCTTGCTAGTATGCTCGAGCATACTAGCAAGGTGCAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_015821.2-1497s21c1
Sequence:CCGGCAGCTATACGCTCAAGCTAAACTCGAGTTTAGCTTGAGCGTATAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015821.2-1321s21c1
Sequence:CCGGCGCCACTACGCTGAAACTTTGCTCGAGCAAAGTTTCAGCGTAGTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_015821.2-968s21c1
Sequence:CCGGAGCCCACTTCTGTGCTCAAACCTCGAGGTTTGAGCACAGAAGTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015821
VALIDATED
FBXL8 MISSION shRNA Lentiviral Transduction Particles
F-box and leucine-rich repeat protein 8
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000194550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015821.1-1245s1c1
Sequence:CCGGGCGCCACTACGATGAAACTTTCTCGAGAAAGTTTCATCGTAGTGGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015821.1-564s1c1
Sequence:CCGGCCACATTCACAACCTAAGGCTCTCGAGAGCCTTAGGTTGTGAATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015821.1-571s1c1
Sequence:CCGGCACAACCTAAGGCTGGAATATCTCGAGATATTCCAGCCTTAGGTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015821.1-582s1c1
Sequence:CCGGGCTGGAATATGAGCCATCAAACTCGAGTTTGATGGCTCATATTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_015821.1-526s1c1
Sequence:CCGGGAAGACTTGTTGCCACCATATCTCGAGATATGGTGGCAACAAGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_015821.2-555s21c1
Sequence:CCGGCAGCACCGTGTGGTCTGATAACTCGAGTTATCAGACCACACGGTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366122    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015821.2-1710s21c1
Sequence:CCGGCCAATCTCAGGCACCATAAATCTCGAGATTTATGGTGCCTGAGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015821.2-1021s21c1
Sequence:CCGGGGACTGCACCTTGCTAGTATGCTCGAGCATACTAGCAAGGTGCAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_015821.2-1497s21c1
Sequence:CCGGCAGCTATACGCTCAAGCTAAACTCGAGTTTAGCTTGAGCGTATAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015821.2-1321s21c1
Sequence:CCGGCGCCACTACGCTGAAACTTTGCTCGAGCAAAGTTTCAGCGTAGTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_015821.2-968s21c1
Sequence:CCGGAGCCCACTTCTGTGCTCAAACCTCGAGGTTTGAGCACAGAAGTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018378
FBXL8 MISSION shRNA Bacterial Glycerol Stock
F-box and leucine-rich repeat protein 8
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000242916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018378.2-388s21c1
Sequence:CCGGATCGAGCTGCTGATGGTTCTGCTCGAGCAGAACCATCAGCAGCTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018378.2-289s21c1
Sequence:CCGGGAAGGCATGCTGCCACCTTATCTCGAGATAAGGTGGCAGCATGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018378.2-624s21c1
Sequence:CCGGTCTGGACAACAGTACCCTAGTCTCGAGACTAGGGTACTGTTGTCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242913    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018378.2-1366s21c1
Sequence:CCGGTACCGAGTTGGGAACTGTGATCTCGAGATCACAGTTCCCAACTCGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018378.2-335s21c1
Sequence:CCGGACAACCTACGGCTGGAATTTGCTCGAGCAAATTCCAGCCGTAGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018378
FBXL8 MISSION shRNA shRNA Plasmid DNA
F-box and leucine-rich repeat protein 8
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000242916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018378.2-388s21c1
Sequence:CCGGATCGAGCTGCTGATGGTTCTGCTCGAGCAGAACCATCAGCAGCTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018378.2-289s21c1
Sequence:CCGGGAAGGCATGCTGCCACCTTATCTCGAGATAAGGTGGCAGCATGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018378.2-624s21c1
Sequence:CCGGTCTGGACAACAGTACCCTAGTCTCGAGACTAGGGTACTGTTGTCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242913    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018378.2-1366s21c1
Sequence:CCGGTACCGAGTTGGGAACTGTGATCTCGAGATCACAGTTCCCAACTCGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018378.2-335s21c1
Sequence:CCGGACAACCTACGGCTGGAATTTGCTCGAGCAAATTCCAGCCGTAGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018378
FBXL8 MISSION shRNA Lentiviral Transduction Particles
F-box and leucine-rich repeat protein 8
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000242916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018378.2-388s21c1
Sequence:CCGGATCGAGCTGCTGATGGTTCTGCTCGAGCAGAACCATCAGCAGCTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018378.2-289s21c1
Sequence:CCGGGAAGGCATGCTGCCACCTTATCTCGAGATAAGGTGGCAGCATGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018378.2-624s21c1
Sequence:CCGGTCTGGACAACAGTACCCTAGTCTCGAGACTAGGGTACTGTTGTCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242913    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018378.2-1366s21c1
Sequence:CCGGTACCGAGTTGGGAACTGTGATCTCGAGATCACAGTTCCCAACTCGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018378.2-335s21c1
Sequence:CCGGACAACCTACGGCTGGAATTTGCTCGAGCAAATTCCAGCCGTAGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks