EMAIL THIS PAGE TO A FRIEND

FBXO10

F-box protein 10

91 Gene Product Result for
Synonyms: FBX10 PRMT11
UniProtKB ID: Q9UK96, Q08AL3, Q5JRT8, Q9UKC3
Gene ID:
Human(26267) Summary: Members of the F-box protein family, such as FBXO10, are characterized by an approximately 40-amino acid F-box motif. SCF complexes, formed by SKP1 (MIM 601434), cullin (see CUL1; MIM 603134), and F-box proteins, act as protein-ubiquitin ligases. F-box proteins interact with SKP1 through the F box, and they interact with ubiquitination targets through other protein interaction domains (Jin et al., 2004 [PubMed 15520277]
Mouse(269529) F-box protein 10
Rat(362511) F-box protein 10
naked mole-rat(101703867) F-box protein 10
sheep(101107163) F-box protein 10
Zebrafish(100334527) F-box protein 10
cow(781854) F-box protein 10
Horse(100066495) F-box protein 10
domestic cat(101101348) F-box protein 10
dog(481613) F-box protein 10
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001024142 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001024142 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001024142 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_012166 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012166 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012166 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU120991 MISSION® esiRNA esiRNA human FBXO10 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012166 Rosetta Predictions human pricing
XM_001071167 Rosetta Predictions rat pricing
XM_342829 Rosetta Predictions rat pricing
XM_001473077 Rosetta Predictions mouse pricing
XM_194139 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012166 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00109682 predicted 2658
2 SASI_Hs01_00109684 predicted 1542
3 SASI_Hs01_00109685 predicted 2052
4 SASI_Hs02_00343763 predicted 1607
5 SASI_Hs02_00343764 predicted 1444
6 SASI_Hs01_00109686 predicted 1891
7 SASI_Hs01_00109687 predicted 1793
8 SASI_Hs01_00109688 predicted 2445
9 SASI_Hs01_00109689 predicted 2694
10 SASI_Hs01_00109690 predicted 2465
11 SASI_Hs01_00109683 predicted 2961
12 SASI_Hs01_00109691 predicted 266
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001071167 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00334074 predicted 2862
2 SASI_Rn02_00334075 predicted 1042
3 SASI_Rn02_00334076 predicted 1803
4 SASI_Rn02_00334077 predicted 1763
5 SASI_Rn02_00334078 predicted 1697
6 SASI_Rn02_00334079 predicted 556
7 SASI_Rn02_00334080 predicted 2213
8 SASI_Rn02_00334081 predicted 1641
9 SASI_Rn02_00334082 predicted 663
10 SASI_Rn02_00334083 predicted 914
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342829 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00394851 predicted 2865
2 SASI_Rn02_00394852 predicted 1046
3 SASI_Rn02_00394853 predicted 1803
4 SASI_Rn02_00394854 predicted 1758
5 SASI_Rn02_00394855 predicted 1699
6 SASI_Rn02_00394856 predicted 551
7 SASI_Rn02_00394857 predicted 2216
8 SASI_Rn02_00394858 predicted 1637
9 SASI_Rn02_00394859 predicted 661
10 SASI_Rn02_00394860 predicted 917
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001473077 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00365787 predicted 1328
2 SASI_Mm02_00365788 predicted 2746
3 SASI_Mm02_00365789 predicted 1617
4 SASI_Mm02_00365790 predicted 1522
5 SASI_Mm02_00365791 predicted 1687
6 SASI_Mm02_00365792 predicted 1466
7 SASI_Mm02_00365793 predicted 1625
8 SASI_Mm02_00365794 predicted 482
9 SASI_Mm02_00365795 predicted 2258
10 SASI_Mm02_00365796 predicted 738
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_194139 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00280374 predicted 1334
2 SASI_Mm01_00280375 predicted 2743
3 SASI_Mm01_00280376 predicted 1610
4 SASI_Mm01_00280377 predicted 1663
5 SASI_Mm01_00280378 predicted 1519
6 SASI_Mm02_00425465 predicted 2962
7 SASI_Mm01_00280379 predicted 1684
8 SASI_Mm01_00280380 predicted 1462
9 SASI_Mm01_00280381 predicted 1625
10 SASI_Mm01_00280382 predicted 2261
11 SASI_Mm01_00280383 predicted 742
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001024142
VALIDATED
FBXO10 MISSION shRNA Bacterial Glycerol Stock
F-box protein 10
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000342183    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001024142.1-3224s21c1
Sequence:CCGGCTCCGGCACTTAGAGGTTATGCTCGAGCATAACCTCTAAGTGCCGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001024142.1-2605s21c1
Sequence:CCGGGTCTGACACTAAGGTACTAAACTCGAGTTTAGTACCTTAGTGTCAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001024142.1-1496s21c1
Sequence:CCGGACTTACGCGGTGCGGTGTATACTCGAGTATACACCGCACCGCGTAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024142.1-1286s21c1
Sequence:CCGGCCGCTACCTGGAGCATCTATTCTCGAGAATAGATGCTCCAGGTAGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001024142.1-2270s21c1
Sequence:CCGGCTCGTGGAGTCCAACAGTATTCTCGAGAATACTGTTGGACTCCACGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001024142
VALIDATED
FBXO10 MISSION shRNA shRNA Plasmid DNA
F-box protein 10
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000342183    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001024142.1-3224s21c1
Sequence:CCGGCTCCGGCACTTAGAGGTTATGCTCGAGCATAACCTCTAAGTGCCGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001024142.1-2605s21c1
Sequence:CCGGGTCTGACACTAAGGTACTAAACTCGAGTTTAGTACCTTAGTGTCAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001024142.1-1496s21c1
Sequence:CCGGACTTACGCGGTGCGGTGTATACTCGAGTATACACCGCACCGCGTAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024142.1-1286s21c1
Sequence:CCGGCCGCTACCTGGAGCATCTATTCTCGAGAATAGATGCTCCAGGTAGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001024142.1-2270s21c1
Sequence:CCGGCTCGTGGAGTCCAACAGTATTCTCGAGAATACTGTTGGACTCCACGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001024142
VALIDATED
FBXO10 MISSION shRNA Lentiviral Transduction Particles
F-box protein 10
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000342183    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001024142.1-3224s21c1
Sequence:CCGGCTCCGGCACTTAGAGGTTATGCTCGAGCATAACCTCTAAGTGCCGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001024142.1-2605s21c1
Sequence:CCGGGTCTGACACTAAGGTACTAAACTCGAGTTTAGTACCTTAGTGTCAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001024142.1-1496s21c1
Sequence:CCGGACTTACGCGGTGCGGTGTATACTCGAGTATACACCGCACCGCGTAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024142.1-1286s21c1
Sequence:CCGGCCGCTACCTGGAGCATCTATTCTCGAGAATAGATGCTCCAGGTAGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001024142.1-2270s21c1
Sequence:CCGGCTCGTGGAGTCCAACAGTATTCTCGAGAATACTGTTGGACTCCACGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012166
FBXO10 MISSION shRNA Bacterial Glycerol Stock
F-box protein 10
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000253919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012166.2-2452s21c1
Sequence:CCGGCAACAGAGGCCACGGCATTATCTCGAGATAATGCCGTGGCCTCTGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253921    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012166.2-3141s21c1
Sequence:CCGGCAGTCACTCGAAGTCTATAAACTCGAGTTTATAGACTTCGAGTGACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012166.2-1473s21c1
Sequence:CCGGTCATGCTCAGGAACGACATTTCTCGAGAAATGTCGTTCCTGAGCATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012166.2-469s21c1
Sequence:CCGGGTACGAAGAGCAAGGTGAAATCTCGAGATTTCACCTTGCTCTTCGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012166.2-1436s21c1
Sequence:CCGGACTTACGCAGTGCGGTGTATACTCGAGTATACACCGCACTGCGTAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012166
FBXO10 MISSION shRNA shRNA Plasmid DNA
F-box protein 10
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000253919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012166.2-2452s21c1
Sequence:CCGGCAACAGAGGCCACGGCATTATCTCGAGATAATGCCGTGGCCTCTGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253921    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012166.2-3141s21c1
Sequence:CCGGCAGTCACTCGAAGTCTATAAACTCGAGTTTATAGACTTCGAGTGACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012166.2-1473s21c1
Sequence:CCGGTCATGCTCAGGAACGACATTTCTCGAGAAATGTCGTTCCTGAGCATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012166.2-469s21c1
Sequence:CCGGGTACGAAGAGCAAGGTGAAATCTCGAGATTTCACCTTGCTCTTCGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012166.2-1436s21c1
Sequence:CCGGACTTACGCAGTGCGGTGTATACTCGAGTATACACCGCACTGCGTAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012166
FBXO10 MISSION shRNA Lentiviral Transduction Particles
F-box protein 10
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000253919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012166.2-2452s21c1
Sequence:CCGGCAACAGAGGCCACGGCATTATCTCGAGATAATGCCGTGGCCTCTGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253921    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012166.2-3141s21c1
Sequence:CCGGCAGTCACTCGAAGTCTATAAACTCGAGTTTATAGACTTCGAGTGACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012166.2-1473s21c1
Sequence:CCGGTCATGCTCAGGAACGACATTTCTCGAGAAATGTCGTTCCTGAGCATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012166.2-469s21c1
Sequence:CCGGGTACGAAGAGCAAGGTGAAATCTCGAGATTTCACCTTGCTCTTCGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012166.2-1436s21c1
Sequence:CCGGACTTACGCAGTGCGGTGTATACTCGAGTATACACCGCACTGCGTAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)