EMAIL THIS PAGE TO A FRIEND

FBXO11

F-box protein 11

202 Gene Product Result for
Synonyms: FBX11 PRMT9 UBR6 VIT1
Gene ID:
Human(80204) Summary: This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class. It can function as an arginine methyltransferase that symmetrically dimethylates arginine residues, and it acts as an adaptor protein to mediate the neddylation of p53, which leads to the suppression of p53 function. This gene is known to be down-regulated in melanocytes from patients with vitiligo, a skin disorder that results in depigmentation. Polymorphisms in this gene are associated with chronic otitis media with effusion and recurrent otitis media (COME/ROM), a hearing loss disorder, and the knockout of the homologous mouse gene results in the deaf mouse mutant Jeff (Jf), a single gene model of otitis media. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jun 2010]
Mouse(225055) F-box protein 11
Rat(301674) F-box protein 11
chicken(421289) F-box protein 11
domestic cat(101087395) F-box protein 11
cow(508172) F-box protein 11
Horse(100053097) F-box protein 11
dog(481363) F-box protein 11
sheep(101107682) F-box protein 11
naked mole-rat(101708599) F-box protein 11
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012167 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012167 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012167 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081034 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081034 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081034 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012167 Rosetta Predictions human pricing
NM_018693 Rosetta Predictions human pricing
NM_025133 Rosetta Predictions human pricing
NM_181631 Rosetta Predictions rat pricing
NM_001081034 Rosetta Predictions mouse pricing
XM_001004113 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012167 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00343765 predicted 1645
2 SASI_Hs01_00106478 predicted 1077
3 SASI_Hs01_00106480 predicted 1143
4 SASI_Hs02_00343766 predicted 1047
5 SASI_Hs01_00106481 predicted 1695
6 SASI_Hs01_00106482 predicted 664
7 SASI_Hs01_00106483 predicted 1274
8 SASI_Hs02_00343767 predicted 1047
9 SASI_Hs01_00106486 predicted 1242
10 SASI_Hs01_00106487 predicted 1114
11 SASI_Hs01_00106479 predicted 1232
12 SASI_Hs01_00106484 predicted 1055
13 SASI_Hs01_00106485 predicted 1034
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018693 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00352216 predicted 1647
2 SASI_Hs01_00224203 predicted 1075
3 SASI_Hs01_00224205 predicted 1148
4 SASI_Hs02_00352217 predicted 1038
5 SASI_Hs01_00224206 predicted 1694
6 SASI_Hs01_00224207 predicted 668
7 SASI_Hs01_00224208 predicted 1274
8 SASI_Hs02_00352218 predicted 1047
9 SASI_Hs01_00224211 predicted 1247
10 SASI_Hs01_00224212 predicted 1114
11 SASI_Hs01_00224204 predicted 1230
12 SASI_Hs01_00224209 predicted 1061
13 SASI_Hs01_00224210 predicted 1033
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025133 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00357844 predicted 1639
2 SASI_Hs01_00166828 predicted 1071
3 SASI_Hs01_00166830 predicted 1144
4 SASI_Hs02_00357845 predicted 1041
5 SASI_Hs01_00166831 predicted 1696
6 SASI_Hs01_00166832 predicted 670
7 SASI_Hs01_00166833 predicted 1273
8 SASI_Hs02_00357846 predicted 1051
9 SASI_Hs01_00166836 predicted 1247
10 SASI_Hs01_00166837 predicted 1115
11 SASI_Hs01_00166829 predicted 1233
12 SASI_Hs01_00166834 predicted 1052
13 SASI_Hs01_00166835 predicted 1031
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181631 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00073536 predicted 2091
2 SASI_Rn01_00073537 predicted 1401
3 SASI_Rn01_00073538 predicted 2403
4 SASI_Rn01_00073539 predicted 2046
5 SASI_Rn01_00073540 predicted 2158
6 SASI_Rn02_00269768 predicted 2568
7 SASI_Rn01_00073541 predicted 1460
8 SASI_Rn01_00073542 predicted 562
9 SASI_Rn01_00073543 predicted 1733
10 SASI_Rn02_00269769 predicted 1481
11 SASI_Rn01_00073535 predicted 1336
12 SASI_Rn01_00073544 predicted 478
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081034 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00294535 predicted 2430
2 SASI_Mm02_00294536 predicted 1018
3 SASI_Mm02_00294537 predicted 2010
4 SASI_Mm02_00294538 predicted 2360
5 SASI_Mm02_00294539 predicted 2680
6 SASI_Mm02_00294540 predicted 2319
7 SASI_Mm02_00294541 predicted 1736
8 SASI_Mm02_00294542 predicted 1142
9 SASI_Mm02_00294543 predicted 1332
10 SASI_Mm02_00294544 predicted 755
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001004113 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00216717 predicted 2435
2 SASI_Mm01_00216718 predicted 1021
3 SASI_Mm01_00216719 predicted 2007
4 SASI_Mm01_00216720 predicted 2364
5 SASI_Mm01_00216721 predicted 2680
6 SASI_Mm01_00216722 predicted 770
7 SASI_Mm01_00216723 predicted 2331
8 SASI_Mm01_00216724 predicted 1735
9 SASI_Mm01_00216725 predicted 1147
10 SASI_Mm01_00216726 predicted 1334
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012167
VALIDATED
FBXO11 MISSION shRNA Bacterial Glycerol Stock
F-box protein 11
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012167.1-1204s21c1
Sequence:GTACCGGGATCATGCACAGGGAATATATCTCGAGATATATTCCCTGTGCATGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012167.1-1274s21c1
Sequence:CCGGATCATGGAAACCCAATTATTACTCGAGTAATAATTGGGTTTCCATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_012167.1-966s21c1
Sequence:CCGGAGATGCTTATGTTGGATATATCTCGAGATATATCCAACATAAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_012167.1-1907s21c1
Sequence:CCGGGAGTGCTAGAAGACAATGATACTCGAGTATCATTGTCTTCTAGCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_012167.1-1057s21c1
Sequence:CCGGGTAAATTGTAGCCCTATTATTCTCGAGAATAATAGGGCTACAATTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012167.1-1343s21c1
Sequence:CCGGATCATGGCATGGGTTACTTTGCTCGAGCAAAGTAACCCATGCCATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012167.1-1695s21c1
Sequence:GTACCGGTTGTCCAATTGTTCGGCATAACTCGAGTTATGCCGAACAATTGGACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_012167.x-1907s1c1
Sequence:CCGGGAGTGCTAGAAGACAATGATACTCGAGTATCATTGTCTTCTAGCACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_012167.x-1117s1c1
Sequence:CCGGGCAGTATGTGTTAGTGGTCAACTCGAGTTGACCACTAACACATACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012167.x-318s1c1
Sequence:CCGGCGCCTCAACTTCAACTACAGACTCGAGTCTGTAGTTGAAGTTGAGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_012167.x-655s1c1
Sequence:CCGGGAGAGTTTCCAGCAGTTGTATCTCGAGATACAACTGCTGGAAACTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012167.x-1765s1c1
Sequence:CCGGCAAGGAGTAATAGAAGAGAATCTCGAGATTCTCTTCTATTACTCCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012167
VALIDATED
FBXO11 MISSION shRNA shRNA Plasmid DNA
F-box protein 11
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012167.1-1204s21c1
Sequence:GTACCGGGATCATGCACAGGGAATATATCTCGAGATATATTCCCTGTGCATGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012167.1-1274s21c1
Sequence:CCGGATCATGGAAACCCAATTATTACTCGAGTAATAATTGGGTTTCCATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_012167.1-966s21c1
Sequence:CCGGAGATGCTTATGTTGGATATATCTCGAGATATATCCAACATAAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_012167.1-1907s21c1
Sequence:CCGGGAGTGCTAGAAGACAATGATACTCGAGTATCATTGTCTTCTAGCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_012167.1-1057s21c1
Sequence:CCGGGTAAATTGTAGCCCTATTATTCTCGAGAATAATAGGGCTACAATTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012167.1-1343s21c1
Sequence:CCGGATCATGGCATGGGTTACTTTGCTCGAGCAAAGTAACCCATGCCATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012167.1-1695s21c1
Sequence:GTACCGGTTGTCCAATTGTTCGGCATAACTCGAGTTATGCCGAACAATTGGACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_012167.x-1907s1c1
Sequence:CCGGGAGTGCTAGAAGACAATGATACTCGAGTATCATTGTCTTCTAGCACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_012167.x-1117s1c1
Sequence:CCGGGCAGTATGTGTTAGTGGTCAACTCGAGTTGACCACTAACACATACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012167.x-318s1c1
Sequence:CCGGCGCCTCAACTTCAACTACAGACTCGAGTCTGTAGTTGAAGTTGAGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_012167.x-655s1c1
Sequence:CCGGGAGAGTTTCCAGCAGTTGTATCTCGAGATACAACTGCTGGAAACTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012167.x-1765s1c1
Sequence:CCGGCAAGGAGTAATAGAAGAGAATCTCGAGATTCTCTTCTATTACTCCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012167
VALIDATED
FBXO11 MISSION shRNA Lentiviral Transduction Particles
F-box protein 11
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012167.1-1204s21c1
Sequence:GTACCGGGATCATGCACAGGGAATATATCTCGAGATATATTCCCTGTGCATGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012167.1-1274s21c1
Sequence:CCGGATCATGGAAACCCAATTATTACTCGAGTAATAATTGGGTTTCCATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_012167.1-966s21c1
Sequence:CCGGAGATGCTTATGTTGGATATATCTCGAGATATATCCAACATAAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_012167.1-1907s21c1
Sequence:CCGGGAGTGCTAGAAGACAATGATACTCGAGTATCATTGTCTTCTAGCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_012167.1-1057s21c1
Sequence:CCGGGTAAATTGTAGCCCTATTATTCTCGAGAATAATAGGGCTACAATTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012167.1-1343s21c1
Sequence:CCGGATCATGGCATGGGTTACTTTGCTCGAGCAAAGTAACCCATGCCATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012167.1-1695s21c1
Sequence:GTACCGGTTGTCCAATTGTTCGGCATAACTCGAGTTATGCCGAACAATTGGACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_012167.x-1907s1c1
Sequence:CCGGGAGTGCTAGAAGACAATGATACTCGAGTATCATTGTCTTCTAGCACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_012167.x-1117s1c1
Sequence:CCGGGCAGTATGTGTTAGTGGTCAACTCGAGTTGACCACTAACACATACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012167.x-318s1c1
Sequence:CCGGCGCCTCAACTTCAACTACAGACTCGAGTCTGTAGTTGAAGTTGAGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_012167.x-655s1c1
Sequence:CCGGGAGAGTTTCCAGCAGTTGTATCTCGAGATACAACTGCTGGAAACTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012167.x-1765s1c1
Sequence:CCGGCAAGGAGTAATAGAAGAGAATCTCGAGATTCTCTTCTATTACTCCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081034
VALIDATED
FBXO11 MISSION shRNA Bacterial Glycerol Stock
F-box protein 11
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000238635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081034.1-688s21c1
Sequence:CCGGGGTAAATTCTACCAGATTAATCTCGAGATTAATCTGGTAGAATTTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081034.1-1782s21c1
Sequence:CCGGTTGTCCTATTGTTCGACATAACTCGAGTTATGTCGAACAATAGGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081034.1-1143s21c1
Sequence:CCGGAGTCAACTGCAGCCCTATTATCTCGAGATAATAGGGCTGCAGTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238632    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081034.1-3762s21c1
Sequence:CCGGTTAAGCTGAGACCAGTATATACTCGAGTATATACTGGTCTCAGCTTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081034.1-790s21c1
Sequence:CCGGGCGGAACATTTCTATAGTAATCTCGAGATTACTATAGAAATGTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081034
VALIDATED
FBXO11 MISSION shRNA shRNA Plasmid DNA
F-box protein 11
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000238635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081034.1-688s21c1
Sequence:CCGGGGTAAATTCTACCAGATTAATCTCGAGATTAATCTGGTAGAATTTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081034.1-1782s21c1
Sequence:CCGGTTGTCCTATTGTTCGACATAACTCGAGTTATGTCGAACAATAGGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081034.1-1143s21c1
Sequence:CCGGAGTCAACTGCAGCCCTATTATCTCGAGATAATAGGGCTGCAGTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238632    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081034.1-3762s21c1
Sequence:CCGGTTAAGCTGAGACCAGTATATACTCGAGTATATACTGGTCTCAGCTTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081034.1-790s21c1
Sequence:CCGGGCGGAACATTTCTATAGTAATCTCGAGATTACTATAGAAATGTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081034
VALIDATED
FBXO11 MISSION shRNA Lentiviral Transduction Particles
F-box protein 11
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000238635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081034.1-688s21c1
Sequence:CCGGGGTAAATTCTACCAGATTAATCTCGAGATTAATCTGGTAGAATTTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081034.1-1782s21c1
Sequence:CCGGTTGTCCTATTGTTCGACATAACTCGAGTTATGTCGAACAATAGGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081034.1-1143s21c1
Sequence:CCGGAGTCAACTGCAGCCCTATTATCTCGAGATAATAGGGCTGCAGTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238632    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081034.1-3762s21c1
Sequence:CCGGTTAAGCTGAGACCAGTATATACTCGAGTATATACTGGTCTCAGCTTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081034.1-790s21c1
Sequence:CCGGGCGGAACATTTCTATAGTAATCTCGAGATTACTATAGAAATGTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks