EMAIL THIS PAGE TO A FRIEND

FBXO15

F-box protein 15

51 Gene Product Result for
Synonyms: FBX15
UniProtKB ID: Q8NCQ5, B3KST3
Gene ID:
Human(201456) Summary: Members of the F-box protein family, such as FBXO15, are characterized by an approximately 40-amino acid F-box motif. SCF complexes, formed by SKP1 (MIM 601434), cullin (see CUL1; MIM 603134), and F-box proteins, act as protein-ubiquitin ligases. F-box proteins interact with SKP1 through the F box, and they interact with ubiquitination targets through other protein interaction domains (Jin et al., 2004 [PubMed 15520277]
Mouse(50764) F-box protein 15
Rat(361354) F-box protein 15
Zebrafish(560664) F-box protein 15
chicken(421017) F-box protein 15
domestic cat(101098494) F-box protein 15
cow(505376) F-box protein 15
Horse(100061530) F-box protein 15
dog(100685224) F-box protein 15
naked mole-rat(101711982) F-box protein 15
sheep(101101855) F-box protein 15
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152676 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152676 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152676 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_015798 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_015798 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_015798 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152676 Rosetta Predictions human pricing
NM_001108436 Rosetta Predictions rat pricing
NM_015798 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152676 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00366567 predicted 1216
2 SASI_Hs01_00062095 predicted 632
3 SASI_Hs01_00062097 predicted 693
4 SASI_Hs01_00062098 predicted 1152
5 SASI_Hs01_00062099 predicted 395
6 SASI_Hs01_00062100 predicted 1029
7 SASI_Hs01_00062101 predicted 1113
8 SASI_Hs02_00366568 predicted 613
9 SASI_Hs01_00062102 predicted 453
10 SASI_Hs01_00062103 predicted 1455
11 SASI_Hs01_00062096 predicted 621
12 SASI_Hs01_00062104 predicted 290
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108436 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00238619 predicted 386
2 SASI_Rn02_00238620 predicted 864
3 SASI_Rn02_00238621 predicted 479
4 SASI_Rn02_00238622 predicted 280
5 SASI_Rn02_00238623 predicted 619
6 SASI_Rn02_00238624 predicted 867
7 SASI_Rn02_00238625 predicted 1178
8 SASI_Rn02_00238626 predicted 1102
9 SASI_Rn02_00238627 predicted 911
10 SASI_Rn02_00238628 predicted 699
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015798 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00169352 predicted 662
2 SASI_Mm01_00169353 predicted 679
3 SASI_Mm01_00169354 predicted 259
4 SASI_Mm01_00169355 predicted 795
5 SASI_Mm01_00169356 predicted 852
6 SASI_Mm01_00169357 predicted 1289
7 SASI_Mm01_00169358 predicted 906
8 SASI_Mm01_00169359 predicted 1060
9 SASI_Mm01_00169360 predicted 878
10 SASI_Mm01_00169361 predicted 1022
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152676
VALIDATED
FBXO15 MISSION shRNA Bacterial Glycerol Stock
F-box protein 15
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000011182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152676.1-403s1c1
Sequence:CCGGCGGAATCTACTCAACTGCTTTCTCGAGAAAGCAGTTGAGTAGATTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152676.1-866s1c1
Sequence:CCGGGCAAAGTACAATCTGAGTCATCTCGAGATGACTCAGATTGTACTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152676.1-1540s1c1
Sequence:CCGGCCTTTATCTTAGTATCGCAAACTCGAGTTTGCGATACTAAGATAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_152676.1-509s1c1
Sequence:CCGGGCTGGTTATTGGAAGAAAGAACTCGAGTTCTTTCTTCCAATAACCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152676.1-831s1c1
Sequence:CCGGCCACCAAACATAGACTCCGATCTCGAGATCGGAGTCTATGTTTGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152676.2-770s21c1
Sequence:CCGGACACATCAGTTACTGTTATATCTCGAGATATAACAGTAACTGATGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152676.2-1559s21c1
Sequence:CCGGAGACCGAAGAATACCTTATTGCTCGAGCAATAAGGTATTCTTCGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152676.2-422s21c1
Sequence:CCGGATCATCTAGCCAATGACAATTCTCGAGAATTGTCATTGGCTAGATGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152676.2-1259s21c1
Sequence:CCGGATGGACATGTGAAGCTCATTGCTCGAGCAATGAGCTTCACATGTCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152676.2-692s21c1
Sequence:CCGGGTTTAGGTTGGGCAATTATACCTCGAGGTATAATTGCCCAACCTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152676
VALIDATED
FBXO15 MISSION shRNA shRNA Plasmid DNA
F-box protein 15
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000011182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152676.1-403s1c1
Sequence:CCGGCGGAATCTACTCAACTGCTTTCTCGAGAAAGCAGTTGAGTAGATTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152676.1-866s1c1
Sequence:CCGGGCAAAGTACAATCTGAGTCATCTCGAGATGACTCAGATTGTACTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152676.1-1540s1c1
Sequence:CCGGCCTTTATCTTAGTATCGCAAACTCGAGTTTGCGATACTAAGATAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_152676.1-509s1c1
Sequence:CCGGGCTGGTTATTGGAAGAAAGAACTCGAGTTCTTTCTTCCAATAACCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152676.1-831s1c1
Sequence:CCGGCCACCAAACATAGACTCCGATCTCGAGATCGGAGTCTATGTTTGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152676.2-770s21c1
Sequence:CCGGACACATCAGTTACTGTTATATCTCGAGATATAACAGTAACTGATGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152676.2-1559s21c1
Sequence:CCGGAGACCGAAGAATACCTTATTGCTCGAGCAATAAGGTATTCTTCGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152676.2-422s21c1
Sequence:CCGGATCATCTAGCCAATGACAATTCTCGAGAATTGTCATTGGCTAGATGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152676.2-1259s21c1
Sequence:CCGGATGGACATGTGAAGCTCATTGCTCGAGCAATGAGCTTCACATGTCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152676.2-692s21c1
Sequence:CCGGGTTTAGGTTGGGCAATTATACCTCGAGGTATAATTGCCCAACCTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152676
VALIDATED
FBXO15 MISSION shRNA Lentiviral Transduction Particles
F-box protein 15
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000011182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152676.1-403s1c1
Sequence:CCGGCGGAATCTACTCAACTGCTTTCTCGAGAAAGCAGTTGAGTAGATTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152676.1-866s1c1
Sequence:CCGGGCAAAGTACAATCTGAGTCATCTCGAGATGACTCAGATTGTACTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152676.1-1540s1c1
Sequence:CCGGCCTTTATCTTAGTATCGCAAACTCGAGTTTGCGATACTAAGATAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_152676.1-509s1c1
Sequence:CCGGGCTGGTTATTGGAAGAAAGAACTCGAGTTCTTTCTTCCAATAACCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152676.1-831s1c1
Sequence:CCGGCCACCAAACATAGACTCCGATCTCGAGATCGGAGTCTATGTTTGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152676.2-770s21c1
Sequence:CCGGACACATCAGTTACTGTTATATCTCGAGATATAACAGTAACTGATGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152676.2-1559s21c1
Sequence:CCGGAGACCGAAGAATACCTTATTGCTCGAGCAATAAGGTATTCTTCGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152676.2-422s21c1
Sequence:CCGGATCATCTAGCCAATGACAATTCTCGAGAATTGTCATTGGCTAGATGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152676.2-1259s21c1
Sequence:CCGGATGGACATGTGAAGCTCATTGCTCGAGCAATGAGCTTCACATGTCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152676.2-692s21c1
Sequence:CCGGGTTTAGGTTGGGCAATTATACCTCGAGGTATAATTGCCCAACCTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015798
FBXO15 MISSION shRNA Bacterial Glycerol Stock
F-box protein 15
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015798.1-395s1c1
Sequence:CCGGCGCAGCTGCATTTAGATCAAACTCGAGTTTGATCTAAATGCAGCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015798.1-272s1c1
Sequence:CCGGGCCATCGGAAATCTTGGTGAACTCGAGTTCACCAAGATTTCCGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015798.1-166s1c1
Sequence:CCGGGTAAGTTTGTTAGAGGCTCATCTCGAGATGAGCCTCTAACAAACTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015798.1-1316s1c1
Sequence:CCGGGAGTTGCATTGTAGTGGATATCTCGAGATATCCACTACAATGCAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015798.1-906s1c1
Sequence:CCGGGTTCGGGTATTCTGTGTAAATCTCGAGATTTACACAGAATACCCGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015798
FBXO15 MISSION shRNA shRNA Plasmid DNA
F-box protein 15
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015798.1-395s1c1
Sequence:CCGGCGCAGCTGCATTTAGATCAAACTCGAGTTTGATCTAAATGCAGCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015798.1-272s1c1
Sequence:CCGGGCCATCGGAAATCTTGGTGAACTCGAGTTCACCAAGATTTCCGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015798.1-166s1c1
Sequence:CCGGGTAAGTTTGTTAGAGGCTCATCTCGAGATGAGCCTCTAACAAACTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015798.1-1316s1c1
Sequence:CCGGGAGTTGCATTGTAGTGGATATCTCGAGATATCCACTACAATGCAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015798.1-906s1c1
Sequence:CCGGGTTCGGGTATTCTGTGTAAATCTCGAGATTTACACAGAATACCCGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015798
FBXO15 MISSION shRNA Lentiviral Transduction Particles
F-box protein 15
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015798.1-395s1c1
Sequence:CCGGCGCAGCTGCATTTAGATCAAACTCGAGTTTGATCTAAATGCAGCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015798.1-272s1c1
Sequence:CCGGGCCATCGGAAATCTTGGTGAACTCGAGTTCACCAAGATTTCCGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015798.1-166s1c1
Sequence:CCGGGTAAGTTTGTTAGAGGCTCATCTCGAGATGAGCCTCTAACAAACTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015798.1-1316s1c1
Sequence:CCGGGAGTTGCATTGTAGTGGATATCTCGAGATATCCACTACAATGCAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015798.1-906s1c1
Sequence:CCGGGTTCGGGTATTCTGTGTAAATCTCGAGATTTACACAGAATACCCGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks