EMAIL THIS PAGE TO A FRIEND

FBXO17

F-box protein 17

77 Gene Product Result for
Synonyms: FBG4 FBX26 FBXO26 Fbx17
UniProtKB ID: Q96EF6, Q96LQ4
Gene ID:
Human(115290) Summary: This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of the ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class and it contains an F-box domain. Alternative splicing of this gene results in 2 transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Mouse(50760) F-box protein 17
Rat(292757) F-box protein 17
dog(484516) F-box protein 17
domestic cat(101092975) F-box protein 17
cow(510874) F-box protein 17
naked mole-rat(101719192) F-box protein 17
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015796 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_015796 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_015796 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024907 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024907 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024907 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024907 Rosetta Predictions human pricing
NM_148169 Rosetta Predictions human pricing
NM_001013064 Rosetta Predictions rat pricing
NM_015796 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024907 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00208213 predicted 769
2 SASI_Hs01_00208214 predicted 831
3 SASI_Hs01_00208215 predicted 820
4 SASI_Hs01_00208216 predicted 650
5 SASI_Hs01_00208217 predicted 771
6 SASI_Hs01_00208218 predicted 487
7 SASI_Hs01_00208219 predicted 648
8 SASI_Hs01_00208220 predicted 381
9 SASI_Hs01_00208221 predicted 798
10 SASI_Hs01_00208222 predicted 682
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_148169 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00089820 predicted 734
2 SASI_Hs01_00089821 predicted 784
3 SASI_Hs01_00089822 predicted 780
4 SASI_Hs01_00089823 predicted 605
5 SASI_Hs01_00089824 predicted 736
6 SASI_Hs01_00089825 predicted 443
7 SASI_Hs01_00089826 predicted 605
8 SASI_Hs01_00089827 predicted 345
9 SASI_Hs01_00089828 predicted 762
10 SASI_Hs01_00089829 predicted 651
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013064 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00106427 predicted 513
2 SASI_Rn02_00200684 predicted 920
3 SASI_Rn02_00200685 predicted 820
4 SASI_Rn02_00200686 predicted 976
5 SASI_Rn01_00106428 predicted 1021
6 SASI_Rn01_00106430 predicted 1132
7 SASI_Rn01_00106431 predicted 439
8 SASI_Rn01_00106432 predicted 997
9 SASI_Rn01_00106429 predicted 966
10 SASI_Rn01_00106433 predicted 320
11 SASI_Rn01_00106434 predicted 885
12 SASI_Rn01_00106435 predicted 1021
13 SASI_Rn01_00106436 predicted 462
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015796 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00152074 predicted 1693
2 SASI_Mm01_00152077 predicted 1701
3 SASI_Mm02_00323157 predicted 1170
4 SASI_Mm02_00323158 predicted 1230
5 SASI_Mm02_00323159 predicted 595
6 SASI_Mm02_00323160 predicted 829
7 SASI_Mm01_00152079 predicted 1000
8 SASI_Mm02_00323161 predicted 1319
9 SASI_Mm02_00323162 predicted 1155
10 SASI_Mm02_00323163 predicted 1489
11 SASI_Mm01_00152075 predicted 985
12 SASI_Mm01_00152076 predicted 1019
13 SASI_Mm01_00152078 predicted 1078
14 SASI_Mm01_00152080 predicted 1154
15 SASI_Mm01_00152081 predicted 905
16 SASI_Mm01_00152082 predicted 918
17 SASI_Mm01_00152083 predicted 1104
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015796
FBXO17 MISSION shRNA Bacterial Glycerol Stock
F-box protein 17
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000087388    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015796.1-1102s1c1
Sequence:CCGGGCAGACATCTTAGGTTGCTATCTCGAGATAGCAACCTAAGATGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015796.1-991s1c1
Sequence:CCGGGTTCGCCTACTGGATGAATATCTCGAGATATTCATCCAGTAGGCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015796.1-1073s1c1
Sequence:CCGGGCTGCCGACAAGGACTACCATCTCGAGATGGTAGTCCTTGTCGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015796.1-957s1c1
Sequence:CCGGCCGTGAGAACTGCGGCTGCATCTCGAGATGCAGCCGCAGTTCTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015796
FBXO17 MISSION shRNA shRNA Plasmid DNA
F-box protein 17
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000087388    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015796.1-1102s1c1
Sequence:CCGGGCAGACATCTTAGGTTGCTATCTCGAGATAGCAACCTAAGATGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015796.1-991s1c1
Sequence:CCGGGTTCGCCTACTGGATGAATATCTCGAGATATTCATCCAGTAGGCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015796.1-1073s1c1
Sequence:CCGGGCTGCCGACAAGGACTACCATCTCGAGATGGTAGTCCTTGTCGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015796.1-957s1c1
Sequence:CCGGCCGTGAGAACTGCGGCTGCATCTCGAGATGCAGCCGCAGTTCTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015796
FBXO17 MISSION shRNA Lentiviral Transduction Particles
F-box protein 17
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000087388    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015796.1-1102s1c1
Sequence:CCGGGCAGACATCTTAGGTTGCTATCTCGAGATAGCAACCTAAGATGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015796.1-991s1c1
Sequence:CCGGGTTCGCCTACTGGATGAATATCTCGAGATATTCATCCAGTAGGCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015796.1-1073s1c1
Sequence:CCGGGCTGCCGACAAGGACTACCATCTCGAGATGGTAGTCCTTGTCGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015796.1-957s1c1
Sequence:CCGGCCGTGAGAACTGCGGCTGCATCTCGAGATGCAGCCGCAGTTCTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024907
FBXO17 MISSION shRNA Bacterial Glycerol Stock
F-box protein 17
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000022434    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_024907.5-1542s1c1
Sequence:CCGGCATTTAGTTCATTTGCCTGCACTCGAGTGCAGGCAAATGAACTAAATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024907.5-803s1c1
Sequence:CCGGGTGGTCAAGTTCTCAGCCTCACTCGAGTGAGGCTGAGAACTTGACCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024907.5-418s1c1
Sequence:CCGGGCCCAGCAACGAAGACAAGGACTCGAGTCCTTGTCTTCGTTGCTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024907.5-489s1c1
Sequence:CCGGGCCGCAATCTCATCTTCAACTCTCGAGAGTTGAAGATGAGATTGCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024907.5-891s1c1
Sequence:CCGGGCAAGGGCATCCGCTACGTATCTCGAGATACGTAGCGGATGCCCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024907.5-803s21c1
Sequence:CCGGGTGGTCAAGTTCTCAGCCTCACTCGAGTGAGGCTGAGAACTTGACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024907.5-418s21c1
Sequence:CCGGGCCCAGCAACGAAGACAAGGACTCGAGTCCTTGTCTTCGTTGCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024907.5-489s21c1
Sequence:CCGGGCCGCAATCTCATCTTCAACTCTCGAGAGTTGAAGATGAGATTGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024907.5-891s21c1
Sequence:CCGGGCAAGGGCATCCGCTACGTATCTCGAGATACGTAGCGGATGCCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024907
FBXO17 MISSION shRNA shRNA Plasmid DNA
F-box protein 17
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000022434    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_024907.5-1542s1c1
Sequence:CCGGCATTTAGTTCATTTGCCTGCACTCGAGTGCAGGCAAATGAACTAAATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024907.5-803s1c1
Sequence:CCGGGTGGTCAAGTTCTCAGCCTCACTCGAGTGAGGCTGAGAACTTGACCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024907.5-418s1c1
Sequence:CCGGGCCCAGCAACGAAGACAAGGACTCGAGTCCTTGTCTTCGTTGCTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024907.5-489s1c1
Sequence:CCGGGCCGCAATCTCATCTTCAACTCTCGAGAGTTGAAGATGAGATTGCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024907.5-891s1c1
Sequence:CCGGGCAAGGGCATCCGCTACGTATCTCGAGATACGTAGCGGATGCCCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024907.5-803s21c1
Sequence:CCGGGTGGTCAAGTTCTCAGCCTCACTCGAGTGAGGCTGAGAACTTGACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024907.5-418s21c1
Sequence:CCGGGCCCAGCAACGAAGACAAGGACTCGAGTCCTTGTCTTCGTTGCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024907.5-489s21c1
Sequence:CCGGGCCGCAATCTCATCTTCAACTCTCGAGAGTTGAAGATGAGATTGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024907.5-891s21c1
Sequence:CCGGGCAAGGGCATCCGCTACGTATCTCGAGATACGTAGCGGATGCCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024907
FBXO17 MISSION shRNA Lentiviral Transduction Particles
F-box protein 17
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000022434    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_024907.5-1542s1c1
Sequence:CCGGCATTTAGTTCATTTGCCTGCACTCGAGTGCAGGCAAATGAACTAAATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024907.5-803s1c1
Sequence:CCGGGTGGTCAAGTTCTCAGCCTCACTCGAGTGAGGCTGAGAACTTGACCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024907.5-418s1c1
Sequence:CCGGGCCCAGCAACGAAGACAAGGACTCGAGTCCTTGTCTTCGTTGCTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024907.5-489s1c1
Sequence:CCGGGCCGCAATCTCATCTTCAACTCTCGAGAGTTGAAGATGAGATTGCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024907.5-891s1c1
Sequence:CCGGGCAAGGGCATCCGCTACGTATCTCGAGATACGTAGCGGATGCCCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024907.5-803s21c1
Sequence:CCGGGTGGTCAAGTTCTCAGCCTCACTCGAGTGAGGCTGAGAACTTGACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024907.5-418s21c1
Sequence:CCGGGCCCAGCAACGAAGACAAGGACTCGAGTCCTTGTCTTCGTTGCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024907.5-489s21c1
Sequence:CCGGGCCGCAATCTCATCTTCAACTCTCGAGAGTTGAAGATGAGATTGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024907.5-891s21c1
Sequence:CCGGGCAAGGGCATCCGCTACGTATCTCGAGATACGTAGCGGATGCCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks