EMAIL THIS PAGE TO A FRIEND

FBXO18

F-box protein, helicase, 18

123 Gene Product Result for
Synonyms: FBH1 Fbx18
Gene ID:
Human(84893) Summary: This gene encodes a member of the F-box protein family, members of which are characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into three classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbx class. It contains an F-box motif and seven conserved helicase motifs, and has both DNA-dependent ATPase and DNA unwinding activities. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Mouse(50755) F-box protein 18
Rat(291293) F-box protein, helicase, 18
sheep(101112918) F-box protein, helicase, 18
naked mole-rat(101719984) F-box protein, helicase, 18
domestic guinea pig(100715614) F-box protein, helicase, 18
Zebrafish(567995) F-box protein, helicase, 18
domestic cat(101099563) F-box protein, helicase, 18
cow(534383) F-box protein, helicase, 18
Horse(100070322) F-box protein, helicase, 18
dog(487142) F-box protein, helicase, 18
chicken(416687) F-box protein, helicase, 18
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032807 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032807 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032807 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_015792 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_015792 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_015792 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032807 Rosetta Predictions human pricing
NM_178150 Rosetta Predictions human pricing
NM_001106119 Rosetta Predictions rat pricing
NM_015792 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032807 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00057770 predicted 2016
2 SASI_Hs02_00360372 predicted 881
3 SASI_Hs01_00057771 predicted 2756
4 SASI_Hs01_00057772 predicted 1148
5 SASI_Hs01_00057773 predicted 2333
6 SASI_Hs01_00057774 predicted 1983
7 SASI_Hs02_00360373 predicted 1567
8 SASI_Hs01_00057776 predicted 837
9 SASI_Hs02_00360374 predicted 3210
10 SASI_Hs02_00360375 predicted 2372
11 SASI_Hs01_00057769 predicted 763
12 SASI_Hs01_00057775 predicted 1466
13 SASI_Hs01_00057777 predicted 2831
14 SASI_Hs01_00057778 predicted 2665
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178150 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00208425 predicted 1854
2 SASI_Hs02_00369552 predicted 721
3 SASI_Hs01_00208426 predicted 2596
4 SASI_Hs01_00208427 predicted 984
5 SASI_Hs01_00208428 predicted 2173
6 SASI_Hs01_00208429 predicted 1815
7 SASI_Hs02_00369553 predicted 1399
8 SASI_Hs02_00369554 predicted 1751
9 SASI_Hs01_00208431 predicted 667
10 SASI_Hs02_00369555 predicted 2210
11 SASI_Hs01_00208424 predicted 592
12 SASI_Hs01_00208430 predicted 1301
13 SASI_Hs01_00208432 predicted 2664
14 SASI_Hs01_00208433 predicted 2505
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106119 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00215808 predicted 2971
2 SASI_Rn02_00215809 predicted 2897
3 SASI_Rn02_00215810 predicted 2551
4 SASI_Rn02_00215811 predicted 2465
5 SASI_Rn02_00215812 predicted 2879
6 SASI_Rn02_00215813 predicted 1964
7 SASI_Rn02_00215814 predicted 1912
8 SASI_Rn02_00215815 predicted 1981
9 SASI_Rn02_00215816 predicted 364
10 SASI_Rn02_00215817 predicted 2838
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015792 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00127517 predicted 1497
2 SASI_Mm01_00127518 predicted 1862
3 SASI_Mm02_00323154 predicted 1726
4 SASI_Mm01_00127520 predicted 3033
5 SASI_Mm01_00127521 predicted 1284
6 SASI_Mm01_00127522 predicted 1943
7 SASI_Mm01_00127523 predicted 2935
8 SASI_Mm01_00127524 predicted 2842
9 SASI_Mm01_00127526 predicted 1397
10 SASI_Mm02_00323155 predicted 1427
11 SASI_Mm01_00127519 predicted 2523
12 SASI_Mm01_00127525 predicted 1939
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032807
FBXO18 MISSION shRNA Bacterial Glycerol Stock
F-box protein, helicase, 18
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000439415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032807.3-1666s21c1
Sequence:CCGGCCTCAACGCTGGTCAAGTATGCTCGAGCATACTTGACCAGCGTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032807.3-2382s21c1
Sequence:CCGGGCTTATGTGGGAGCTACTATCCTCGAGGATAGTAGCTCCCACATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032807.3-2272s21c1
Sequence:CCGGACCCGCACCAGCAGATCTATACTCGAGTATAGATCTGCTGGTGCGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032807.3-339s21c1
Sequence:CCGGTTCGGTCAAAGATGGACAAACCTCGAGGTTTGTCCATCTTTGACCGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032807.3-2660s1c1
Sequence:CCGGCCTCGTCATTAAAGACAAATTCTCGAGAATTTGTCTTTAATGACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032807.3-251s1c1
Sequence:CCGGCGCTGAAATGAGACGGTTTAACTCGAGTTAAACCGTCTCATTTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032807.3-1982s1c1
Sequence:CCGGCGTGCCTATTTGGTGTAAGAACTCGAGTTCTTACACCAAATAGGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032807.3-1595s1c1
Sequence:CCGGGCTGATTCTGAATCACAAGATCTCGAGATCTTGTGATTCAGAATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032807.3-834s1c1
Sequence:CCGGCCTGACTCATACTATGGGCTTCTCGAGAAGCCCATAGTATGAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032807
FBXO18 MISSION shRNA shRNA Plasmid DNA
F-box protein, helicase, 18
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000439415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032807.3-1666s21c1
Sequence:CCGGCCTCAACGCTGGTCAAGTATGCTCGAGCATACTTGACCAGCGTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032807.3-2382s21c1
Sequence:CCGGGCTTATGTGGGAGCTACTATCCTCGAGGATAGTAGCTCCCACATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032807.3-2272s21c1
Sequence:CCGGACCCGCACCAGCAGATCTATACTCGAGTATAGATCTGCTGGTGCGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032807.3-339s21c1
Sequence:CCGGTTCGGTCAAAGATGGACAAACCTCGAGGTTTGTCCATCTTTGACCGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032807.3-2660s1c1
Sequence:CCGGCCTCGTCATTAAAGACAAATTCTCGAGAATTTGTCTTTAATGACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032807.3-251s1c1
Sequence:CCGGCGCTGAAATGAGACGGTTTAACTCGAGTTAAACCGTCTCATTTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032807.3-1982s1c1
Sequence:CCGGCGTGCCTATTTGGTGTAAGAACTCGAGTTCTTACACCAAATAGGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032807.3-1595s1c1
Sequence:CCGGGCTGATTCTGAATCACAAGATCTCGAGATCTTGTGATTCAGAATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032807.3-834s1c1
Sequence:CCGGCCTGACTCATACTATGGGCTTCTCGAGAAGCCCATAGTATGAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032807
FBXO18 MISSION shRNA Lentiviral Transduction Particles
F-box protein, helicase, 18
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000439415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032807.3-1666s21c1
Sequence:CCGGCCTCAACGCTGGTCAAGTATGCTCGAGCATACTTGACCAGCGTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032807.3-2382s21c1
Sequence:CCGGGCTTATGTGGGAGCTACTATCCTCGAGGATAGTAGCTCCCACATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032807.3-2272s21c1
Sequence:CCGGACCCGCACCAGCAGATCTATACTCGAGTATAGATCTGCTGGTGCGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032807.3-339s21c1
Sequence:CCGGTTCGGTCAAAGATGGACAAACCTCGAGGTTTGTCCATCTTTGACCGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032807.3-2660s1c1
Sequence:CCGGCCTCGTCATTAAAGACAAATTCTCGAGAATTTGTCTTTAATGACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032807.3-251s1c1
Sequence:CCGGCGCTGAAATGAGACGGTTTAACTCGAGTTAAACCGTCTCATTTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032807.3-1982s1c1
Sequence:CCGGCGTGCCTATTTGGTGTAAGAACTCGAGTTCTTACACCAAATAGGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032807.3-1595s1c1
Sequence:CCGGGCTGATTCTGAATCACAAGATCTCGAGATCTTGTGATTCAGAATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032807.3-834s1c1
Sequence:CCGGCCTGACTCATACTATGGGCTTCTCGAGAAGCCCATAGTATGAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015792
VALIDATED
FBXO18 MISSION shRNA Bacterial Glycerol Stock
F-box protein, helicase, 18
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000328351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015792.1-214s21c1
Sequence:CCGGGTCTCTATCCTAGACCCAGAACTCGAGTTCTGGGTCTAGGATAGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015792.1-1223s21c1
Sequence:CCGGAGATGTCACCGAGACCTTATACTCGAGTATAAGGTCTCGGTGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_015792.1-255s21c1
Sequence:CCGGCGAGGATGTCAGAGATATATTCTCGAGAATATATCTCTGACATCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353414    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_015792.1-3300s21c1
Sequence:CCGGGCATCTCTGAGGAGGAAGATACTCGAGTATCTTCCTCCTCAGAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120957    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_015792.1-3300s1c1
Sequence:CCGGGCATCTCTGAGGAGGAAGATACTCGAGTATCTTCCTCCTCAGAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_015792.1-214s1c1
Sequence:CCGGGTCTCTATCCTAGACCCAGAACTCGAGTTCTGGGTCTAGGATAGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_015792.1-1947s1c1
Sequence:CCGGGCATACCAAATGACACATGATCTCGAGATCATGTGTCATTTGGTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015792.1-2391s1c1
Sequence:CCGGCCTGCAAGGATACATTTGATTCTCGAGAATCAAATGTATCCTTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_015792.1-255s1c1
Sequence:CCGGCGAGGATGTCAGAGATATATTCTCGAGAATATATCTCTGACATCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015792
VALIDATED
FBXO18 MISSION shRNA shRNA Plasmid DNA
F-box protein, helicase, 18
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000328351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015792.1-214s21c1
Sequence:CCGGGTCTCTATCCTAGACCCAGAACTCGAGTTCTGGGTCTAGGATAGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015792.1-1223s21c1
Sequence:CCGGAGATGTCACCGAGACCTTATACTCGAGTATAAGGTCTCGGTGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_015792.1-255s21c1
Sequence:CCGGCGAGGATGTCAGAGATATATTCTCGAGAATATATCTCTGACATCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353414    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_015792.1-3300s21c1
Sequence:CCGGGCATCTCTGAGGAGGAAGATACTCGAGTATCTTCCTCCTCAGAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120957    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_015792.1-3300s1c1
Sequence:CCGGGCATCTCTGAGGAGGAAGATACTCGAGTATCTTCCTCCTCAGAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_015792.1-214s1c1
Sequence:CCGGGTCTCTATCCTAGACCCAGAACTCGAGTTCTGGGTCTAGGATAGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_015792.1-1947s1c1
Sequence:CCGGGCATACCAAATGACACATGATCTCGAGATCATGTGTCATTTGGTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015792.1-2391s1c1
Sequence:CCGGCCTGCAAGGATACATTTGATTCTCGAGAATCAAATGTATCCTTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_015792.1-255s1c1
Sequence:CCGGCGAGGATGTCAGAGATATATTCTCGAGAATATATCTCTGACATCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015792
VALIDATED
FBXO18 MISSION shRNA Lentiviral Transduction Particles
F-box protein, helicase, 18
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000328351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015792.1-214s21c1
Sequence:CCGGGTCTCTATCCTAGACCCAGAACTCGAGTTCTGGGTCTAGGATAGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015792.1-1223s21c1
Sequence:CCGGAGATGTCACCGAGACCTTATACTCGAGTATAAGGTCTCGGTGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_015792.1-255s21c1
Sequence:CCGGCGAGGATGTCAGAGATATATTCTCGAGAATATATCTCTGACATCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353414    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_015792.1-3300s21c1
Sequence:CCGGGCATCTCTGAGGAGGAAGATACTCGAGTATCTTCCTCCTCAGAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120957    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_015792.1-3300s1c1
Sequence:CCGGGCATCTCTGAGGAGGAAGATACTCGAGTATCTTCCTCCTCAGAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_015792.1-214s1c1
Sequence:CCGGGTCTCTATCCTAGACCCAGAACTCGAGTTCTGGGTCTAGGATAGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_015792.1-1947s1c1
Sequence:CCGGGCATACCAAATGACACATGATCTCGAGATCATGTGTCATTTGGTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015792.1-2391s1c1
Sequence:CCGGCCTGCAAGGATACATTTGATTCTCGAGAATCAAATGTATCCTTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_015792.1-255s1c1
Sequence:CCGGCGAGGATGTCAGAGATATATTCTCGAGAATATATCTCTGACATCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks