EMAIL THIS PAGE TO A FRIEND

FBXO21

F-box protein 21

143 Gene Product Result for
Synonyms: FBX21
UniProtKB ID: O94952, B3KMF0, Q5BJG0, Q9H087
Gene ID:
Human(23014) Summary: This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class. Alternative splicing of this gene generates 2 transcript variants. [provided by RefSeq, Jul 2008]
Mouse(231670) F-box protein 21
Rat(360818) F-box protein 21
sheep(100188916) F-box protein 21
Domestic Rabbit(100350525) F-box protein 21
naked mole-rat(101712825) F-box protein 21
Zebrafish(567738) F-box protein 21
cow(617252) F-box protein 21
Horse(100055074) F-box protein 21
domestic cat(101091656) F-box protein 21
dog(486290) F-box protein 21
chicken(427722) F-box protein 21
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015002 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015002 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015002 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145564 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145564 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145564 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015002 Rosetta Predictions human pricing
NM_033624 Rosetta Predictions human pricing
NM_001108338 Rosetta Predictions rat pricing
NM_145564 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015002 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00032099 predicted 1886
2 SASI_Hs02_00346773 predicted 1841
3 SASI_Hs01_00032100 predicted 897
4 SASI_Hs01_00032102 predicted 1886
5 SASI_Hs01_00032103 predicted 866
6 SASI_Hs01_00032104 predicted 878
7 SASI_Hs01_00032105 predicted 1928
8 SASI_Hs01_00032106 predicted 820
9 SASI_Hs01_00032107 predicted 935
10 SASI_Hs01_00032108 predicted 774
11 SASI_Hs01_00032101 predicted 788
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033624 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00210946 predicted 1912
2 SASI_Hs02_00361431 predicted 1865
3 SASI_Hs01_00210947 predicted 896
4 SASI_Hs01_00210949 predicted 1905
5 SASI_Hs01_00210950 predicted 862
6 SASI_Hs01_00210951 predicted 882
7 SASI_Hs01_00210952 predicted 1953
8 SASI_Hs01_00210953 predicted 824
9 SASI_Hs01_00210954 predicted 932
10 SASI_Hs01_00210955 predicted 776
11 SASI_Hs01_00210948 predicted 784
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108338 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00237679 predicted 1392
2 SASI_Rn02_00237680 predicted 1162
3 SASI_Rn02_00237681 predicted 1031
4 SASI_Rn02_00237682 predicted 571
5 SASI_Rn02_00237683 predicted 456
6 SASI_Rn02_00237684 predicted 949
7 SASI_Rn02_00237685 predicted 825
8 SASI_Rn02_00237686 predicted 1599
9 SASI_Rn02_00237687 predicted 1137
10 SASI_Rn02_00237688 predicted 868
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145564 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00076232 predicted 986
2 SASI_Mm01_00076233 predicted 1145
3 SASI_Mm01_00076234 predicted 503
4 SASI_Mm01_00076235 predicted 1701
5 SASI_Mm01_00076236 predicted 1114
6 SASI_Mm01_00076237 predicted 356
7 SASI_Mm01_00076238 predicted 302
8 SASI_Mm01_00076239 predicted 1568
9 SASI_Mm01_00076240 predicted 779
10 SASI_Mm01_00076241 predicted 617
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015002
VALIDATED
FBXO21 MISSION shRNA Bacterial Glycerol Stock
F-box protein 21
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000299823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015002.2-559s21c1
Sequence:CCGGCGGCAACAGAAGATCTTAAATCTCGAGATTTAAGATCTTCTGTTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_015002.2-1272s21c1
Sequence:CCGGGCTGGATCTCTATCTGGCAATCTCGAGATTGCCAGATAGAGATCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_015002.2-1059s21c1
Sequence:CCGGCCTGGACATCTTTGACTACATCTCGAGATGTAGTCAAAGATGTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_015002.2-1533s21c1
Sequence:CCGGCGGGCTCATTATGAAGCATAACTCGAGTTATGCTTCATAATGAGCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015002.2-282s21c1
Sequence:CCGGGCCTTCCCTTATGAAACACTACTCGAGTAGTGTTTCATAAGGGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015002.1-1507s1c1
Sequence:CCGGCGGGCTCATTATGAAGCATAACTCGAGTTATGCTTCATAATGAGCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015002.1-533s1c1
Sequence:CCGGCGGCAACAGAAGATCTTAAATCTCGAGATTTAAGATCTTCTGTTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015002.1-1033s1c1
Sequence:CCGGCCTGGACATCTTTGACTACATCTCGAGATGTAGTCAAAGATGTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015002.1-1246s1c1
Sequence:CCGGGCTGGATCTCTATCTGGCAATCTCGAGATTGCCAGATAGAGATCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015002
VALIDATED
FBXO21 MISSION shRNA shRNA Plasmid DNA
F-box protein 21
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000299823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015002.2-559s21c1
Sequence:CCGGCGGCAACAGAAGATCTTAAATCTCGAGATTTAAGATCTTCTGTTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_015002.2-1272s21c1
Sequence:CCGGGCTGGATCTCTATCTGGCAATCTCGAGATTGCCAGATAGAGATCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_015002.2-1059s21c1
Sequence:CCGGCCTGGACATCTTTGACTACATCTCGAGATGTAGTCAAAGATGTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_015002.2-1533s21c1
Sequence:CCGGCGGGCTCATTATGAAGCATAACTCGAGTTATGCTTCATAATGAGCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015002.2-282s21c1
Sequence:CCGGGCCTTCCCTTATGAAACACTACTCGAGTAGTGTTTCATAAGGGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015002.1-1507s1c1
Sequence:CCGGCGGGCTCATTATGAAGCATAACTCGAGTTATGCTTCATAATGAGCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015002.1-533s1c1
Sequence:CCGGCGGCAACAGAAGATCTTAAATCTCGAGATTTAAGATCTTCTGTTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015002.1-1033s1c1
Sequence:CCGGCCTGGACATCTTTGACTACATCTCGAGATGTAGTCAAAGATGTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015002.1-1246s1c1
Sequence:CCGGGCTGGATCTCTATCTGGCAATCTCGAGATTGCCAGATAGAGATCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015002
VALIDATED
FBXO21 MISSION shRNA Lentiviral Transduction Particles
F-box protein 21
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000299823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015002.2-559s21c1
Sequence:CCGGCGGCAACAGAAGATCTTAAATCTCGAGATTTAAGATCTTCTGTTGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_015002.2-1272s21c1
Sequence:CCGGGCTGGATCTCTATCTGGCAATCTCGAGATTGCCAGATAGAGATCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_015002.2-1059s21c1
Sequence:CCGGCCTGGACATCTTTGACTACATCTCGAGATGTAGTCAAAGATGTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_015002.2-1533s21c1
Sequence:CCGGCGGGCTCATTATGAAGCATAACTCGAGTTATGCTTCATAATGAGCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015002.2-282s21c1
Sequence:CCGGGCCTTCCCTTATGAAACACTACTCGAGTAGTGTTTCATAAGGGAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015002.1-1507s1c1
Sequence:CCGGCGGGCTCATTATGAAGCATAACTCGAGTTATGCTTCATAATGAGCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015002.1-533s1c1
Sequence:CCGGCGGCAACAGAAGATCTTAAATCTCGAGATTTAAGATCTTCTGTTGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015002.1-1033s1c1
Sequence:CCGGCCTGGACATCTTTGACTACATCTCGAGATGTAGTCAAAGATGTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015002.1-1246s1c1
Sequence:CCGGGCTGGATCTCTATCTGGCAATCTCGAGATTGCCAGATAGAGATCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145564
VALIDATED
FBXO21 MISSION shRNA Bacterial Glycerol Stock
F-box protein 21
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000247511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145564.3-313s21c1
Sequence:CCGGCAATTGGTTAGAGGAATATAACTCGAGTTATATTCCTCTAACCAATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145564.3-613s21c1
Sequence:CCGGCTATCTCGAAGGTGCCGTTTACTCGAGTAAACGGCACCTTCGAGATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145564.3-813s21c1
Sequence:CCGGTGCTGGACGCTATCAACTATGCTCGAGCATAGTTGATAGCGTCCAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247514    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145564.3-3634s21c1
Sequence:CCGGACTCGTGTAAGTTGGTATTTGCTCGAGCAAATACCAACTTACACGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145564.3-1896s21c1
Sequence:CCGGAGGAGGACACAGCCGAGTAAACTCGAGTTTACTCGGCTGTGTCCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191924    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145564.2-1877s1c1
Sequence:CCGGGCAGAATATTTACAGTGCAAACTCGAGTTTGCACTGTAAATATTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190627    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145564.2-2314s1c1
Sequence:CCGGGCCTTCCGTTAGATTGTACTTCTCGAGAAGTACAATCTAACGGAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189829    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145564.2-1103s1c1
Sequence:CCGGGCTGACAGTGAAAGAGTGTGACTCGAGTCACACTCTTTCACTGTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145564
VALIDATED
FBXO21 MISSION shRNA shRNA Plasmid DNA
F-box protein 21
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000247511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145564.3-313s21c1
Sequence:CCGGCAATTGGTTAGAGGAATATAACTCGAGTTATATTCCTCTAACCAATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145564.3-613s21c1
Sequence:CCGGCTATCTCGAAGGTGCCGTTTACTCGAGTAAACGGCACCTTCGAGATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145564.3-813s21c1
Sequence:CCGGTGCTGGACGCTATCAACTATGCTCGAGCATAGTTGATAGCGTCCAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247514    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145564.3-3634s21c1
Sequence:CCGGACTCGTGTAAGTTGGTATTTGCTCGAGCAAATACCAACTTACACGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145564.3-1896s21c1
Sequence:CCGGAGGAGGACACAGCCGAGTAAACTCGAGTTTACTCGGCTGTGTCCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191924    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145564.2-1877s1c1
Sequence:CCGGGCAGAATATTTACAGTGCAAACTCGAGTTTGCACTGTAAATATTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190627    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145564.2-2314s1c1
Sequence:CCGGGCCTTCCGTTAGATTGTACTTCTCGAGAAGTACAATCTAACGGAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189829    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145564.2-1103s1c1
Sequence:CCGGGCTGACAGTGAAAGAGTGTGACTCGAGTCACACTCTTTCACTGTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145564
VALIDATED
FBXO21 MISSION shRNA Lentiviral Transduction Particles
F-box protein 21
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000247511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145564.3-313s21c1
Sequence:CCGGCAATTGGTTAGAGGAATATAACTCGAGTTATATTCCTCTAACCAATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145564.3-613s21c1
Sequence:CCGGCTATCTCGAAGGTGCCGTTTACTCGAGTAAACGGCACCTTCGAGATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145564.3-813s21c1
Sequence:CCGGTGCTGGACGCTATCAACTATGCTCGAGCATAGTTGATAGCGTCCAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247514    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145564.3-3634s21c1
Sequence:CCGGACTCGTGTAAGTTGGTATTTGCTCGAGCAAATACCAACTTACACGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145564.3-1896s21c1
Sequence:CCGGAGGAGGACACAGCCGAGTAAACTCGAGTTTACTCGGCTGTGTCCTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191924    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145564.2-1877s1c1
Sequence:CCGGGCAGAATATTTACAGTGCAAACTCGAGTTTGCACTGTAAATATTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190627    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145564.2-2314s1c1
Sequence:CCGGGCCTTCCGTTAGATTGTACTTCTCGAGAAGTACAATCTAACGGAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189829    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145564.2-1103s1c1
Sequence:CCGGGCTGACAGTGAAAGAGTGTGACTCGAGTCACACTCTTTCACTGTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)