EMAIL THIS PAGE TO A FRIEND

FBXO22

F-box protein 22

71 Gene Product Result for
Synonyms: FBX22 FISTC1
UniProtKB ID: Q8NEZ5, Q0D2P8, Q6PIL5, Q8IXW3, Q9H824, Q9UKC0
Gene ID:
Human(26263) Summary: This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of the ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class and, as a transcriptional target of the tumor protein p53, is thought to be involved in degradation of specific proteins in response to p53 induction. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2010]
Mouse(71999) F-box protein 22
Rat(300724) F-box protein 22
Zebrafish(556909) F-box protein 22
dog(487672) F-box protein 22
Horse(100050726) F-box protein 22
cow(536605) F-box protein 22
domestic cat(101094853) F-box protein 22
chicken(415355) F-box protein 22
naked mole-rat(101697256) F-box protein 22
sheep(101102339) F-box protein 22
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012170 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012170 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012170 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028049 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028049 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028049 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012170 Rosetta Predictions human pricing
NM_147188 Rosetta Predictions human pricing
NM_001037770 Rosetta Predictions rat pricing
NM_028049 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012170 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00094988 predicted 458
2 SASI_Hs01_00094989 predicted 440
3 SASI_Hs02_00343769 predicted 557
4 SASI_Hs02_00343770 predicted 635
5 SASI_Hs01_00094991 predicted 259
6 SASI_Hs01_00094992 predicted 600
7 SASI_Hs02_00343771 predicted 401
8 SASI_Hs01_00094994 predicted 445
9 SASI_Hs01_00094995 predicted 418
10 SASI_Hs01_00094996 predicted 390
11 SASI_Hs01_00094990 predicted 420
12 SASI_Hs01_00094993 predicted 564
13 SASI_Hs01_00094997 predicted 385
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_147188 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00084609 predicted 458
2 SASI_Hs01_00084610 predicted 440
3 SASI_Hs02_00365529 predicted 558
4 SASI_Hs02_00365530 predicted 638
5 SASI_Hs01_00084612 predicted 254
6 SASI_Hs01_00084613 predicted 605
7 SASI_Hs02_00365531 predicted 401
8 SASI_Hs01_00084615 predicted 446
9 SASI_Hs01_00084616 predicted 421
10 SASI_Hs01_00084617 predicted 386
11 SASI_Hs01_00084611 predicted 422
12 SASI_Hs01_00084614 predicted 563
13 SASI_Hs01_00084618 predicted 389
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037770 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00034452 predicted 987
2 SASI_Rn01_00034453 predicted 306
3 SASI_Rn01_00034454 predicted 851
4 SASI_Rn01_00034456 predicted 468
5 SASI_Rn01_00034457 predicted 810
6 SASI_Rn01_00034458 predicted 1073
7 SASI_Rn01_00034459 predicted 552
8 SASI_Rn02_00204558 predicted 1167
9 SASI_Rn01_00034460 predicted 519
10 SASI_Rn01_00034461 predicted 854
11 SASI_Rn01_00034455 predicted 793
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028049 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00333223 predicted 634
2 SASI_Mm02_00333224 predicted 944
3 SASI_Mm02_00333225 predicted 1073
4 SASI_Mm02_00333226 predicted 648
5 SASI_Mm02_00333227 predicted 1338
6 SASI_Mm02_00333228 predicted 613
7 SASI_Mm02_00333229 predicted 592
8 SASI_Mm02_00333230 predicted 735
9 SASI_Mm02_00333231 predicted 697
10 SASI_Mm02_00333232 predicted 1342
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012170
VALIDATED
FBXO22 MISSION shRNA Bacterial Glycerol Stock
F-box protein 22
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012170.x-758s1c1
Sequence:CCGGGTGTGGTCCTTGTCTTTGGTTCTCGAGAACCAAAGACAAGGACCACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012170.x-754s1c1
Sequence:CCGGCTTCGTGTGGTCCTTGTCTTTCTCGAGAAAGACAAGGACCACACGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012170.x-523s1c1
Sequence:CCGGCCCAAACAATGCCAAGTCCTTCTCGAGAAGGACTTGGCATTGTTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012170.x-391s1c1
Sequence:CCGGCGCATCTTACCACATACAGTTCTCGAGAACTGTATGTGGTAAGATGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012170.x-587s1c1
Sequence:CCGGGTAGCAATCGACCTCAGGAAACTCGAGTTTCCTGAGGTCGATTGCTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012170.2-160s21c1
Sequence:CCGGAGCACCTTCGTGTTGAGTAACCTCGAGGTTACTCAACACGAAGGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012170.2-822s21c1
Sequence:CCGGAGTCAGCACTTTCAGTGATATCTCGAGATATCACTGAAAGTGCTGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012170
VALIDATED
FBXO22 MISSION shRNA shRNA Plasmid DNA
F-box protein 22
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012170.x-758s1c1
Sequence:CCGGGTGTGGTCCTTGTCTTTGGTTCTCGAGAACCAAAGACAAGGACCACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012170.x-754s1c1
Sequence:CCGGCTTCGTGTGGTCCTTGTCTTTCTCGAGAAAGACAAGGACCACACGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012170.x-523s1c1
Sequence:CCGGCCCAAACAATGCCAAGTCCTTCTCGAGAAGGACTTGGCATTGTTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012170.x-391s1c1
Sequence:CCGGCGCATCTTACCACATACAGTTCTCGAGAACTGTATGTGGTAAGATGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012170.x-587s1c1
Sequence:CCGGGTAGCAATCGACCTCAGGAAACTCGAGTTTCCTGAGGTCGATTGCTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012170.2-160s21c1
Sequence:CCGGAGCACCTTCGTGTTGAGTAACCTCGAGGTTACTCAACACGAAGGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012170.2-822s21c1
Sequence:CCGGAGTCAGCACTTTCAGTGATATCTCGAGATATCACTGAAAGTGCTGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012170
VALIDATED
FBXO22 MISSION shRNA Lentiviral Transduction Particles
F-box protein 22
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012170.x-758s1c1
Sequence:CCGGGTGTGGTCCTTGTCTTTGGTTCTCGAGAACCAAAGACAAGGACCACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012170.x-754s1c1
Sequence:CCGGCTTCGTGTGGTCCTTGTCTTTCTCGAGAAAGACAAGGACCACACGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012170.x-523s1c1
Sequence:CCGGCCCAAACAATGCCAAGTCCTTCTCGAGAAGGACTTGGCATTGTTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012170.x-391s1c1
Sequence:CCGGCGCATCTTACCACATACAGTTCTCGAGAACTGTATGTGGTAAGATGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012170.x-587s1c1
Sequence:CCGGGTAGCAATCGACCTCAGGAAACTCGAGTTTCCTGAGGTCGATTGCTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012170.2-160s21c1
Sequence:CCGGAGCACCTTCGTGTTGAGTAACCTCGAGGTTACTCAACACGAAGGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012170.2-822s21c1
Sequence:CCGGAGTCAGCACTTTCAGTGATATCTCGAGATATCACTGAAAGTGCTGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028049
VALIDATED
FBXO22 MISSION shRNA Bacterial Glycerol Stock
F-box protein 22
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000194517    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028049.1-1717s1c1
Sequence:CCGGGCCTGGTCTATAGAGTGAGTTCTCGAGAACTCACTCTATAGACCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028049.1-1215s1c1
Sequence:CCGGCCATAGCTACACAACCATCATCTCGAGATGATGGTTGTGTAGCTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028049.1-1179s1c1
Sequence:CCGGGAGGAGATGTAATGAGGTAAACTCGAGTTTACCTCATTACATCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028049.1-1177s1c1
Sequence:CCGGCTGAGGAGATGTAATGAGGTACTCGAGTACCTCATTACATCTCCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175683    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028049.1-1400s1c1
Sequence:CCGGGAGGTCACTTTGGGATGATTTCTCGAGAAATCATCCCAAAGTGACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028049.1-776s1c1
Sequence:CCGGGCACTTTCAGCGATATGAATACTCGAGTATTCATATCGCTGAAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028049.2-1239s21c1
Sequence:CCGGGAGGAGATGTAATGAGGTAAACTCGAGTTTACCTCATTACATCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216836    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028049.2-904s1c1
Sequence:CCGGGAGAAGAACCCTCTGGATATTCTCGAGAATATCCAGAGGGTTCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215784    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028049.2-641s1c1
Sequence:CCGGCTTTATTATTCCCTCAAATTGCTCGAGCAATTTGAGGGAATAATAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216970    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028049.2-604s1c1
Sequence:CCGGCGACCTCAGGAAATAGAAATTCTCGAGAATTTCTATTTCCTGAGGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028049.2-836s21c1
Sequence:CCGGGCACTTTCAGCGATATGAATACTCGAGTATTCATATCGCTGAAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028049.2-1275s21c1
Sequence:CCGGCCATAGCTACACAACCATCATCTCGAGATGATGGTTGTGTAGCTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320040    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028049.2-1460s21c1
Sequence:CCGGGAGGTCACTTTGGGATGATTTCTCGAGAAATCATCCCAAAGTGACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028049
VALIDATED
FBXO22 MISSION shRNA shRNA Plasmid DNA
F-box protein 22
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000194517    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028049.1-1717s1c1
Sequence:CCGGGCCTGGTCTATAGAGTGAGTTCTCGAGAACTCACTCTATAGACCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028049.1-1215s1c1
Sequence:CCGGCCATAGCTACACAACCATCATCTCGAGATGATGGTTGTGTAGCTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028049.1-1179s1c1
Sequence:CCGGGAGGAGATGTAATGAGGTAAACTCGAGTTTACCTCATTACATCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028049.1-1177s1c1
Sequence:CCGGCTGAGGAGATGTAATGAGGTACTCGAGTACCTCATTACATCTCCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175683    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028049.1-1400s1c1
Sequence:CCGGGAGGTCACTTTGGGATGATTTCTCGAGAAATCATCCCAAAGTGACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028049.1-776s1c1
Sequence:CCGGGCACTTTCAGCGATATGAATACTCGAGTATTCATATCGCTGAAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028049.2-1239s21c1
Sequence:CCGGGAGGAGATGTAATGAGGTAAACTCGAGTTTACCTCATTACATCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216836    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028049.2-904s1c1
Sequence:CCGGGAGAAGAACCCTCTGGATATTCTCGAGAATATCCAGAGGGTTCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215784    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028049.2-641s1c1
Sequence:CCGGCTTTATTATTCCCTCAAATTGCTCGAGCAATTTGAGGGAATAATAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216970    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028049.2-604s1c1
Sequence:CCGGCGACCTCAGGAAATAGAAATTCTCGAGAATTTCTATTTCCTGAGGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028049.2-836s21c1
Sequence:CCGGGCACTTTCAGCGATATGAATACTCGAGTATTCATATCGCTGAAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028049.2-1275s21c1
Sequence:CCGGCCATAGCTACACAACCATCATCTCGAGATGATGGTTGTGTAGCTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320040    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028049.2-1460s21c1
Sequence:CCGGGAGGTCACTTTGGGATGATTTCTCGAGAAATCATCCCAAAGTGACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028049
VALIDATED
FBXO22 MISSION shRNA Lentiviral Transduction Particles
F-box protein 22
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000194517    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028049.1-1717s1c1
Sequence:CCGGGCCTGGTCTATAGAGTGAGTTCTCGAGAACTCACTCTATAGACCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028049.1-1215s1c1
Sequence:CCGGCCATAGCTACACAACCATCATCTCGAGATGATGGTTGTGTAGCTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028049.1-1179s1c1
Sequence:CCGGGAGGAGATGTAATGAGGTAAACTCGAGTTTACCTCATTACATCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028049.1-1177s1c1
Sequence:CCGGCTGAGGAGATGTAATGAGGTACTCGAGTACCTCATTACATCTCCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175683    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028049.1-1400s1c1
Sequence:CCGGGAGGTCACTTTGGGATGATTTCTCGAGAAATCATCCCAAAGTGACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028049.1-776s1c1
Sequence:CCGGGCACTTTCAGCGATATGAATACTCGAGTATTCATATCGCTGAAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028049.2-1239s21c1
Sequence:CCGGGAGGAGATGTAATGAGGTAAACTCGAGTTTACCTCATTACATCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216836    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028049.2-904s1c1
Sequence:CCGGGAGAAGAACCCTCTGGATATTCTCGAGAATATCCAGAGGGTTCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215784    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028049.2-641s1c1
Sequence:CCGGCTTTATTATTCCCTCAAATTGCTCGAGCAATTTGAGGGAATAATAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216970    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028049.2-604s1c1
Sequence:CCGGCGACCTCAGGAAATAGAAATTCTCGAGAATTTCTATTTCCTGAGGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028049.2-836s21c1
Sequence:CCGGGCACTTTCAGCGATATGAATACTCGAGTATTCATATCGCTGAAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028049.2-1275s21c1
Sequence:CCGGCCATAGCTACACAACCATCATCTCGAGATGATGGTTGTGTAGCTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320040    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028049.2-1460s21c1
Sequence:CCGGGAGGTCACTTTGGGATGATTTCTCGAGAAATCATCCCAAAGTGACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks