EMAIL THIS PAGE TO A FRIEND

FBXO24

F-box protein 24

93 Gene Product Result for
Synonyms: FBX24
UniProtKB ID: O75426, A4D2D4, B4DX91, B4DY42, Q9H0G1
Gene ID:
Human(26261) Summary: This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of the ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2009]
Mouse(71176) F-box protein 24
Rat(304374) F-box protein 24
dog(608428) F-box protein 24
cow(512170) F-box protein 24
domestic cat(101091580) F-box protein 24
sheep(101104291) F-box protein 24
naked mole-rat(101717717) F-box protein 24
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012172 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012172 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012172 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_132440 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_132440 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_132440 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU157571 MISSION® esiRNA esiRNA human FBXO24 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012172 Rosetta Predictions human pricing
NM_033506 Rosetta Predictions human pricing
NM_001107130 Rosetta Predictions rat pricing
XM_132440 Rosetta Predictions mouse pricing
XM_916784 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012172 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00029650 predicted 823
2 SASI_Hs01_00029651 predicted 293
3 SASI_Hs01_00029652 predicted 839
4 SASI_Hs02_00343774 predicted 826
5 SASI_Hs01_00029653 predicted 824
6 SASI_Hs01_00029654 predicted 826
7 SASI_Hs01_00029655 predicted 839
8 SASI_Hs01_00029656 predicted 767
9 SASI_Hs02_00343775 predicted 826
10 SASI_Hs01_00029658 predicted 817
11 SASI_Hs01_00029657 predicted 928
12 SASI_Hs01_00029659 predicted 304
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033506 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00117238 predicted 867
2 SASI_Hs01_00117239 predicted 291
3 SASI_Hs01_00117240 predicted 881
4 SASI_Hs02_00361378 predicted 874
5 SASI_Hs01_00117241 predicted 870
6 SASI_Hs01_00117242 predicted 871
7 SASI_Hs01_00117243 predicted 882
8 SASI_Hs01_00117244 predicted 813
9 SASI_Hs02_00361379 predicted 867
10 SASI_Hs01_00117246 predicted 860
11 SASI_Hs01_00117245 predicted 965
12 SASI_Hs01_00117247 predicted 297
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107130 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00225796 predicted 1245
2 SASI_Rn02_00225797 predicted 289
3 SASI_Rn02_00225798 predicted 639
4 SASI_Rn02_00225799 predicted 295
5 SASI_Rn02_00225800 predicted 765
6 SASI_Rn02_00225801 predicted 1285
7 SASI_Rn02_00225802 predicted 1511
8 SASI_Rn02_00225803 predicted 1289
9 SASI_Rn02_00225804 predicted 1568
10 SASI_Rn02_00225805 predicted 1056
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_132440 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00208486 predicted 1049
2 SASI_Mm01_00208487 predicted 670
3 SASI_Mm01_00208488 predicted 765
4 SASI_Mm01_00208489 predicted 876
5 SASI_Mm01_00208490 predicted 1572
6 SASI_Mm01_00208491 predicted 1246
7 SASI_Mm01_00208492 predicted 400
8 SASI_Mm01_00208493 predicted 939
9 SASI_Mm01_00208494 predicted 1423
10 SASI_Mm01_00208495 predicted 905
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_916784 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00440610 predicted 1053
2 SASI_Mm02_00440611 predicted 671
3 SASI_Mm02_00440612 predicted 761
4 SASI_Mm02_00440613 predicted 868
5 SASI_Mm02_00440614 predicted 1573
6 SASI_Mm02_00440615 predicted 1249
7 SASI_Mm02_00440616 predicted 406
8 SASI_Mm02_00440617 predicted 940
9 SASI_Mm02_00440618 predicted 1424
10 SASI_Mm02_00440619 predicted 898
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012172
VALIDATED
FBXO24 MISSION shRNA Bacterial Glycerol Stock
F-box protein 24
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012172.4-761s21c1
Sequence:CCGGTGACACAGTTTACCGTAAATACTCGAGTATTTACGGTAAACTGTGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012172.4-844s21c1
Sequence:CCGGGTGACTGTGTTGAGGTCTATCCTCGAGGATAGACCTCAACACAGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427646    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012172.4-1994s21c1
Sequence:CCGGACCATTGTGCACATGCGTGTGCTCGAGCACACGCATGTGCACAATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012172.4-988s21c1
Sequence:CCGGTCTACTCTTTGGTAGTGAATGCTCGAGCATTCACTACCAAAGAGTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012172.4-607s21c1
Sequence:CCGGCCAAGGATCACGTCTTCATTCCTCGAGGAATGAAGACGTGATCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012172.4-502s21c1
Sequence:CCGGACTACACGAAGGGCCTGTATTCTCGAGAATACAGGCCCTTCGTGTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012172.4-894s21c1
Sequence:CCGGATGACATTCCACCACTCAATGCTCGAGCATTGAGTGGTGGAATGTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_012172.x-1013s1c1
Sequence:CCGGGTAGTGAATGAGACCCAGCTTCTCGAGAAGCTGGGTCTCATTCACTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_012172.x-717s1c1
Sequence:CCGGCCTGTCGCTATGTTGTGTTGTCTCGAGACAACACAACATAGCGACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_012172.x-1110s1c1
Sequence:CCGGGCATGACTTCCAACCAGAGCACTCGAGTGCTCTGGTTGGAAGTCATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_012172.x-383s1c1
Sequence:CCGGCATATCATCTCATTCCTCCCACTCGAGTGGGAGGAATGAGATGATATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004313    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_012172.x-1210s1c1
Sequence:CCGGTCATGCAAGGAAATAACAGATCTCGAGATCTGTTATTTCCTTGCATGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012172
VALIDATED
FBXO24 MISSION shRNA shRNA Plasmid DNA
F-box protein 24
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012172.4-761s21c1
Sequence:CCGGTGACACAGTTTACCGTAAATACTCGAGTATTTACGGTAAACTGTGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012172.4-844s21c1
Sequence:CCGGGTGACTGTGTTGAGGTCTATCCTCGAGGATAGACCTCAACACAGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427646    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012172.4-1994s21c1
Sequence:CCGGACCATTGTGCACATGCGTGTGCTCGAGCACACGCATGTGCACAATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012172.4-988s21c1
Sequence:CCGGTCTACTCTTTGGTAGTGAATGCTCGAGCATTCACTACCAAAGAGTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012172.4-607s21c1
Sequence:CCGGCCAAGGATCACGTCTTCATTCCTCGAGGAATGAAGACGTGATCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012172.4-502s21c1
Sequence:CCGGACTACACGAAGGGCCTGTATTCTCGAGAATACAGGCCCTTCGTGTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012172.4-894s21c1
Sequence:CCGGATGACATTCCACCACTCAATGCTCGAGCATTGAGTGGTGGAATGTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_012172.x-1013s1c1
Sequence:CCGGGTAGTGAATGAGACCCAGCTTCTCGAGAAGCTGGGTCTCATTCACTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_012172.x-717s1c1
Sequence:CCGGCCTGTCGCTATGTTGTGTTGTCTCGAGACAACACAACATAGCGACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_012172.x-1110s1c1
Sequence:CCGGGCATGACTTCCAACCAGAGCACTCGAGTGCTCTGGTTGGAAGTCATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_012172.x-383s1c1
Sequence:CCGGCATATCATCTCATTCCTCCCACTCGAGTGGGAGGAATGAGATGATATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004313    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_012172.x-1210s1c1
Sequence:CCGGTCATGCAAGGAAATAACAGATCTCGAGATCTGTTATTTCCTTGCATGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012172
VALIDATED
FBXO24 MISSION shRNA Lentiviral Transduction Particles
F-box protein 24
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012172.4-761s21c1
Sequence:CCGGTGACACAGTTTACCGTAAATACTCGAGTATTTACGGTAAACTGTGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012172.4-844s21c1
Sequence:CCGGGTGACTGTGTTGAGGTCTATCCTCGAGGATAGACCTCAACACAGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427646    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012172.4-1994s21c1
Sequence:CCGGACCATTGTGCACATGCGTGTGCTCGAGCACACGCATGTGCACAATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012172.4-988s21c1
Sequence:CCGGTCTACTCTTTGGTAGTGAATGCTCGAGCATTCACTACCAAAGAGTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012172.4-607s21c1
Sequence:CCGGCCAAGGATCACGTCTTCATTCCTCGAGGAATGAAGACGTGATCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012172.4-502s21c1
Sequence:CCGGACTACACGAAGGGCCTGTATTCTCGAGAATACAGGCCCTTCGTGTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012172.4-894s21c1
Sequence:CCGGATGACATTCCACCACTCAATGCTCGAGCATTGAGTGGTGGAATGTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_012172.x-1013s1c1
Sequence:CCGGGTAGTGAATGAGACCCAGCTTCTCGAGAAGCTGGGTCTCATTCACTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_012172.x-717s1c1
Sequence:CCGGCCTGTCGCTATGTTGTGTTGTCTCGAGACAACACAACATAGCGACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_012172.x-1110s1c1
Sequence:CCGGGCATGACTTCCAACCAGAGCACTCGAGTGCTCTGGTTGGAAGTCATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_012172.x-383s1c1
Sequence:CCGGCATATCATCTCATTCCTCCCACTCGAGTGGGAGGAATGAGATGATATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004313    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_012172.x-1210s1c1
Sequence:CCGGTCATGCAAGGAAATAACAGATCTCGAGATCTGTTATTTCCTTGCATGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_132440
FBXO24 MISSION shRNA Bacterial Glycerol Stock
F-box protein 24
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000092523    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_132440.1-1978s1c1
Sequence:CCGGCAGAGAACACTGTGTGTACATCTCGAGATGTACACACAGTGTTCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132440.1-1296s1c1
Sequence:CCGGCGGATCTTTATGCAGGGAAATCTCGAGATTTCCCTGCATAAAGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132440.1-948s1c1
Sequence:CCGGCGCTCCTATACAGTGCAGTTACTCGAGTAACTGCACTGTATAGGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132440.1-1028s1c1
Sequence:CCGGCCAGAGCAGTACCCTCTATATCTCGAGATATAGAGGGTACTGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132440.1-403s1c1
Sequence:CCGGGAGCTGCCATTCTTAACTATACTCGAGTATAGTTAAGAATGGCAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_132440
FBXO24 MISSION shRNA shRNA Plasmid DNA
F-box protein 24
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000092523    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_132440.1-1978s1c1
Sequence:CCGGCAGAGAACACTGTGTGTACATCTCGAGATGTACACACAGTGTTCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132440.1-1296s1c1
Sequence:CCGGCGGATCTTTATGCAGGGAAATCTCGAGATTTCCCTGCATAAAGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132440.1-948s1c1
Sequence:CCGGCGCTCCTATACAGTGCAGTTACTCGAGTAACTGCACTGTATAGGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132440.1-1028s1c1
Sequence:CCGGCCAGAGCAGTACCCTCTATATCTCGAGATATAGAGGGTACTGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132440.1-403s1c1
Sequence:CCGGGAGCTGCCATTCTTAACTATACTCGAGTATAGTTAAGAATGGCAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_132440
FBXO24 MISSION shRNA Lentiviral Transduction Particles
F-box protein 24
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000092523    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_132440.1-1978s1c1
Sequence:CCGGCAGAGAACACTGTGTGTACATCTCGAGATGTACACACAGTGTTCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132440.1-1296s1c1
Sequence:CCGGCGGATCTTTATGCAGGGAAATCTCGAGATTTCCCTGCATAAAGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132440.1-948s1c1
Sequence:CCGGCGCTCCTATACAGTGCAGTTACTCGAGTAACTGCACTGTATAGGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132440.1-1028s1c1
Sequence:CCGGCCAGAGCAGTACCCTCTATATCTCGAGATATAGAGGGTACTGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132440.1-403s1c1
Sequence:CCGGGAGCTGCCATTCTTAACTATACTCGAGTATAGTTAAGAATGGCAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks