EMAIL THIS PAGE TO A FRIEND

FBXO25

F-box protein 25

Synonyms: FBX25
UniProtKB ID: Q8TCJ0, Q6PJ83, Q7Z4V4, Q9UKB8
Gene ID:
Human(26260) Summary: This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class. Three alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(66822) F-box protein 25
Rat(364637) F-box protein 25
naked mole-rat(101696866) F-box protein 25
sheep(101113718) F-box protein 25
Domestic Rabbit(100357540) F-box protein 25
Zebrafish(403037) F-box protein 25
cow(540328) F-box protein 25
Horse(100051951) F-box protein 25
domestic cat(101100125) F-box protein 25
dog(608099) F-box protein 25
chicken(421906) F-box protein 25
83 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108572 Anti-FBXO25 IgG fraction of antiserum rat, human, rabbit, canine, guinea pig, bovine, mouse, horse, zebrafish
immunohistochemistry, western blot pricing
SAB2108130 Anti-FBXO25 antibody produced in rabbit affinity isolated antibody mouse, rabbit, canine, human, pig, horse, bovine, zebrafish, rat, guinea pig
western blot pricing
AV43118 Anti-FBXO25 antibody produced in rabbit IgG fraction of antiserum canine, pig, guinea pig, bovine, horse, zebrafish, rat, mouse, human, rabbit
immunohistochemistry, western blot pricing
WH0026260M1 Monoclonal Anti-FBXO25 antibody produced in mouse clone 2F1, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012173 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012173 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012173 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025785 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025785 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025785 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU005521 MISSION® esiRNA esiRNA targeting mouse Fbxo25 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012173 Rosetta Predictions human pricing
NM_183420 Rosetta Predictions human pricing
NM_183421 Rosetta Predictions human pricing
NM_001014239 Rosetta Predictions rat pricing
NM_025785 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012173 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00187866 predicted 1460
2 SASI_Hs01_00187867 predicted 1475
3 SASI_Hs02_00343776 predicted 1694
4 SASI_Hs01_00187868 predicted 805
5 SASI_Hs01_00187870 predicted 1613
6 SASI_Hs01_00187871 predicted 705
7 SASI_Hs02_00343777 predicted 1605
8 SASI_Hs01_00187872 predicted 754
9 SASI_Hs01_00187873 predicted 1772
10 SASI_Hs02_00343778 predicted 781
11 SASI_Hs01_00187865 predicted 1709
12 SASI_Hs01_00187869 predicted 1412
13 SASI_Hs01_00187874 predicted 932
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183420 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00239953 predicted 1508
2 SASI_Hs01_00239954 predicted 1524
3 SASI_Hs02_00371321 predicted 1744
4 SASI_Hs01_00239955 predicted 862
5 SASI_Hs01_00239957 predicted 1659
6 SASI_Hs01_00239958 predicted 752
7 SASI_Hs02_00371322 predicted 1656
8 SASI_Hs01_00239959 predicted 803
9 SASI_Hs01_00239960 predicted 1822
10 SASI_Hs02_00371323 predicted 829
11 SASI_Hs01_00239952 predicted 1752
12 SASI_Hs01_00239956 predicted 1468
13 SASI_Hs01_00239961 predicted 978
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183421 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00121852 predicted 1535
2 SASI_Hs01_00121853 predicted 1557
3 SASI_Hs02_00371324 predicted 1767
4 SASI_Hs01_00121854 predicted 859
5 SASI_Hs01_00121856 predicted 1683
6 SASI_Hs01_00121857 predicted 755
7 SASI_Hs02_00371325 predicted 1684
8 SASI_Hs01_00121858 predicted 796
9 SASI_Hs01_00121859 predicted 1847
10 SASI_Hs02_00371326 predicted 836
11 SASI_Hs01_00121851 predicted 1778
12 SASI_Hs01_00121855 predicted 1495
13 SASI_Hs01_00121860 predicted 979
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014239 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00104869 predicted 515
2 SASI_Rn01_00104870 predicted 606
3 SASI_Rn02_00201790 predicted 459
4 SASI_Rn02_00201791 predicted 1408
5 SASI_Rn01_00104872 predicted 395
6 SASI_Rn01_00104873 predicted 306
7 SASI_Rn01_00104874 predicted 386
8 SASI_Rn01_00104875 predicted 1380
9 SASI_Rn01_00104876 predicted 631
10 SASI_Rn01_00104877 predicted 845
11 SASI_Rn01_00104868 predicted 556
12 SASI_Rn01_00104871 predicted 682
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025785 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00190739 predicted 430
2 SASI_Mm01_00190740 predicted 485
3 SASI_Mm01_00190741 predicted 224
4 SASI_Mm01_00190742 predicted 209
5 SASI_Mm01_00190743 predicted 424
6 SASI_Mm01_00190744 predicted 932
7 SASI_Mm01_00190745 predicted 707
8 SASI_Mm01_00190746 predicted 1179
9 SASI_Mm01_00190747 predicted 428
10 SASI_Mm01_00190748 predicted 1205
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012173
VALIDATED
FBXO25 MISSION shRNA Bacterial Glycerol Stock
F-box protein 25
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000004317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012173.x-1125s1c1
Sequence:CCGGTCAGAAACATTACCCAGCGAACTCGAGTTCGCTGGGTAATGTTTCTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004319    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012173.x-1819s1c1
Sequence:CCGGGCCATTCTTGTCTTAGGGATTCTCGAGAATCCCTAAGACAAGAATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012173.x-702s1c1
Sequence:CCGGCCACCACAATCCTCGCTTAATCTCGAGATTAAGCGAGGATTGTGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012173.x-1152s1c1
Sequence:CCGGGTACGGAGACACACTGCATTTCTCGAGAAATGCAGTGTGTCTCCGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012173.x-780s1c1
Sequence:CCGGGAAGTCTGTATTAGTGGGAAACTCGAGTTTCCCACTAATACAGACTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_012173.3-790s21c1
Sequence:CCGGTTAGTGGGAAACATCAATATTCTCGAGAATATTGATGTTTCCCACTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314574    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012173.3-1608s21c1
Sequence:CCGGACGTGACACTAACGGCCAATACTCGAGTATTGGCCGTTAGTGTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_012173.3-1152s21c1
Sequence:CCGGGTACGGAGACACACTGCATTTCTCGAGAAATGCAGTGTGTCTCCGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_012173.3-702s21c1
Sequence:CCGGCCACCACAATCCTCGCTTAATCTCGAGATTAAGCGAGGATTGTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012173
VALIDATED
FBXO25 MISSION shRNA shRNA Plasmid DNA
F-box protein 25
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000004317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012173.x-1125s1c1
Sequence:CCGGTCAGAAACATTACCCAGCGAACTCGAGTTCGCTGGGTAATGTTTCTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004319    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012173.x-1819s1c1
Sequence:CCGGGCCATTCTTGTCTTAGGGATTCTCGAGAATCCCTAAGACAAGAATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012173.x-702s1c1
Sequence:CCGGCCACCACAATCCTCGCTTAATCTCGAGATTAAGCGAGGATTGTGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012173.x-1152s1c1
Sequence:CCGGGTACGGAGACACACTGCATTTCTCGAGAAATGCAGTGTGTCTCCGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012173.x-780s1c1
Sequence:CCGGGAAGTCTGTATTAGTGGGAAACTCGAGTTTCCCACTAATACAGACTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_012173.3-790s21c1
Sequence:CCGGTTAGTGGGAAACATCAATATTCTCGAGAATATTGATGTTTCCCACTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314574    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012173.3-1608s21c1
Sequence:CCGGACGTGACACTAACGGCCAATACTCGAGTATTGGCCGTTAGTGTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_012173.3-1152s21c1
Sequence:CCGGGTACGGAGACACACTGCATTTCTCGAGAAATGCAGTGTGTCTCCGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_012173.3-702s21c1
Sequence:CCGGCCACCACAATCCTCGCTTAATCTCGAGATTAAGCGAGGATTGTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012173
VALIDATED
FBXO25 MISSION shRNA Lentiviral Transduction Particles
F-box protein 25
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000004317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012173.x-1125s1c1
Sequence:CCGGTCAGAAACATTACCCAGCGAACTCGAGTTCGCTGGGTAATGTTTCTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004319    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012173.x-1819s1c1
Sequence:CCGGGCCATTCTTGTCTTAGGGATTCTCGAGAATCCCTAAGACAAGAATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012173.x-702s1c1
Sequence:CCGGCCACCACAATCCTCGCTTAATCTCGAGATTAAGCGAGGATTGTGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012173.x-1152s1c1
Sequence:CCGGGTACGGAGACACACTGCATTTCTCGAGAAATGCAGTGTGTCTCCGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012173.x-780s1c1
Sequence:CCGGGAAGTCTGTATTAGTGGGAAACTCGAGTTTCCCACTAATACAGACTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_012173.3-790s21c1
Sequence:CCGGTTAGTGGGAAACATCAATATTCTCGAGAATATTGATGTTTCCCACTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314574    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012173.3-1608s21c1
Sequence:CCGGACGTGACACTAACGGCCAATACTCGAGTATTGGCCGTTAGTGTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_012173.3-1152s21c1
Sequence:CCGGGTACGGAGACACACTGCATTTCTCGAGAAATGCAGTGTGTCTCCGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_012173.3-702s21c1
Sequence:CCGGCCACCACAATCCTCGCTTAATCTCGAGATTAAGCGAGGATTGTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025785
VALIDATED
FBXO25 MISSION shRNA Bacterial Glycerol Stock
F-box protein 25
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025785.1-183s1c1
Sequence:CCGGCACCATCAACCACAGCATTATCTCGAGATAATGCTGTGGTTGATGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025785.1-711s1c1
Sequence:CCGGCCAGGTGACAAAGCAGGTAAACTCGAGTTTACCTGCTTTGTCACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025785.1-954s1c1
Sequence:CCGGGCTGATGTATTTCACGCTTCACTCGAGTGAAGCGTGAAATACATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201018    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025785.1-1346s1c1
Sequence:CCGGCGACTCCATTTGTACTTCTTTCTCGAGAAAGAAGTACAAATGGAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339872    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025785.2-1345s21c1
Sequence:CCGGCGACTCCATTTGTACTTCTTTCTCGAGAAAGAAGTACAAATGGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025785.2-182s21c1
Sequence:CCGGCACCATCAACCACAGCATTATCTCGAGATAATGCTGTGGTTGATGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025785.2-953s21c1
Sequence:CCGGGCTGATGTATTTCACGCTTCACTCGAGTGAAGCGTGAAATACATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025785.2-439s21c1
Sequence:CCGGTCAAACTACTGCAGCTAATTGCTCGAGCAATTAGCTGCAGTAGTTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025785
VALIDATED
FBXO25 MISSION shRNA shRNA Plasmid DNA
F-box protein 25
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025785.1-183s1c1
Sequence:CCGGCACCATCAACCACAGCATTATCTCGAGATAATGCTGTGGTTGATGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025785.1-711s1c1
Sequence:CCGGCCAGGTGACAAAGCAGGTAAACTCGAGTTTACCTGCTTTGTCACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025785.1-954s1c1
Sequence:CCGGGCTGATGTATTTCACGCTTCACTCGAGTGAAGCGTGAAATACATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201018    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025785.1-1346s1c1
Sequence:CCGGCGACTCCATTTGTACTTCTTTCTCGAGAAAGAAGTACAAATGGAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339872    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025785.2-1345s21c1
Sequence:CCGGCGACTCCATTTGTACTTCTTTCTCGAGAAAGAAGTACAAATGGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025785.2-182s21c1
Sequence:CCGGCACCATCAACCACAGCATTATCTCGAGATAATGCTGTGGTTGATGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025785.2-953s21c1
Sequence:CCGGGCTGATGTATTTCACGCTTCACTCGAGTGAAGCGTGAAATACATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025785.2-439s21c1
Sequence:CCGGTCAAACTACTGCAGCTAATTGCTCGAGCAATTAGCTGCAGTAGTTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025785
VALIDATED
FBXO25 MISSION shRNA Lentiviral Transduction Particles
F-box protein 25
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025785.1-183s1c1
Sequence:CCGGCACCATCAACCACAGCATTATCTCGAGATAATGCTGTGGTTGATGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025785.1-711s1c1
Sequence:CCGGCCAGGTGACAAAGCAGGTAAACTCGAGTTTACCTGCTTTGTCACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025785.1-954s1c1
Sequence:CCGGGCTGATGTATTTCACGCTTCACTCGAGTGAAGCGTGAAATACATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201018    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025785.1-1346s1c1
Sequence:CCGGCGACTCCATTTGTACTTCTTTCTCGAGAAAGAAGTACAAATGGAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339872    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025785.2-1345s21c1
Sequence:CCGGCGACTCCATTTGTACTTCTTTCTCGAGAAAGAAGTACAAATGGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025785.2-182s21c1
Sequence:CCGGCACCATCAACCACAGCATTATCTCGAGATAATGCTGTGGTTGATGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025785.2-953s21c1
Sequence:CCGGGCTGATGTATTTCACGCTTCACTCGAGTGAAGCGTGAAATACATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025785.2-439s21c1
Sequence:CCGGTCAAACTACTGCAGCTAATTGCTCGAGCAATTAGCTGCAGTAGTTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks