EMAIL THIS PAGE TO A FRIEND

FBXO27

F-box protein 27

Synonyms: FBG5 Fbx27
UniProtKB ID: Q8NI29, Q96C87
Gene ID:
Human(126433) Summary: Members of the F-box protein family, such as FBXO27, are characterized by an approximately 40-amino acid F-box motif. SCF complexes, formed by SKP1 (MIM 601434), cullin (see CUL1; MIM 603134), and F-box proteins, act as protein-ubiquitin ligases. F-box proteins interact with SKP1 through the F box, and they interact with ubiquitination targets through other protein interaction domains (Jin et al., 2004 [PubMed 15520277]
Mouse(233040) F-box protein 27
dog(484515) F-box protein 27
domestic cat(101092722) F-box protein 27
naked mole-rat(101719542) F-box protein 27
81 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178820 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178820 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178820 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_207238 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_207238 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_207238 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU033271 MISSION® esiRNA esiRNA human FBXO27 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178820 Rosetta Predictions human pricing
NM_207238 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178820 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00181652 predicted 529
2 SASI_Hs01_00181653 predicted 821
3 SASI_Hs01_00181655 predicted 1074
4 SASI_Hs01_00181656 predicted 625
5 SASI_Hs01_00181657 predicted 936
6 SASI_Hs02_00369861 predicted 1081
7 SASI_Hs02_00369862 predicted 680
8 SASI_Hs02_00369863 predicted 779
9 SASI_Hs02_00369864 predicted 449
10 SASI_Hs02_00369865 predicted 1084
11 SASI_Hs01_00181654 predicted 861
12 SASI_Hs01_00181658 predicted 722
13 SASI_Hs01_00181659 predicted 1107
14 SASI_Hs01_00181660 predicted 613
15 SASI_Hs01_00181661 predicted 860
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207238 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00035805 predicted 736
2 SASI_Mm01_00035806 predicted 915
3 SASI_Mm01_00035808 predicted 808
4 SASI_Mm01_00035809 predicted 730
5 SASI_Mm01_00035810 predicted 1163
6 SASI_Mm01_00035811 predicted 442
7 SASI_Mm01_00035812 predicted 1357
8 SASI_Mm01_00035813 predicted 913
9 SASI_Mm01_00035814 predicted 1458
10 SASI_Mm02_00351964 predicted 509
11 SASI_Mm01_00035807 predicted 1455
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178820
VALIDATED
FBXO27 MISSION shRNA Bacterial Glycerol Stock
F-box protein 27
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000376403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178820.3-536s21c1
Sequence:CCGGACGTGCTTCGTGACTTCATTCCTCGAGGAATGAAGTCACGAAGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_178820.3-826s21c1
Sequence:CCGGCCGCTTTGTGTCTTTCGAACACTCGAGTGTTCGAAAGACACAAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_178820.3-621s21c1
Sequence:CCGGATAGTGGCAGGATTGAGATTTCTCGAGAAATCTCAATCCTGCCACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178820.3-407s21c1
Sequence:CCGGCCCATCGGACGCAACCTTATTCTCGAGAATAAGGTTGCGTCCGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178820.3-688s21c1
Sequence:CCGGCAGACTCCTCGTCCAACTTCTCTCGAGAGAAGTTGGACGAGGAGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369047    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178820.3-1090s21c1
Sequence:CCGGAGGTTCTAGAAACTACCAGAACTCGAGTTCTGGTAGTTTCTAGAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369105    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_178820.3-1312s21c1
Sequence:CCGGCTGACCTCTTGTCTCCTATTGCTCGAGCAATAGGAGACAAGAGGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007792    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178820.3-1387s1c1
Sequence:CCGGGAACTTAGAATCTCATCCTTACTCGAGTAAGGATGAGATTCTAAGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178820.3-796s1c1
Sequence:CCGGCCACGTGTTCTCCAACATCAACTCGAGTTGATGTTGGAGAACACGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_178820.3-714s1c1
Sequence:CCGGCCAACCAGACTGTTCTAGATACTCGAGTATCTAGAACAGTCTGGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178820.3-767s1c1
Sequence:CCGGTGGAACAACAATGCCTGCCTTCTCGAGAAGGCAGGCATTGTTGTTCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_178820.3-535s1c1
Sequence:CCGGGACGTGCTTCGTGACTTCATTCTCGAGAATGAAGTCACGAAGCACGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178820
VALIDATED
FBXO27 MISSION shRNA shRNA Plasmid DNA
F-box protein 27
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000376403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178820.3-536s21c1
Sequence:CCGGACGTGCTTCGTGACTTCATTCCTCGAGGAATGAAGTCACGAAGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_178820.3-826s21c1
Sequence:CCGGCCGCTTTGTGTCTTTCGAACACTCGAGTGTTCGAAAGACACAAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_178820.3-621s21c1
Sequence:CCGGATAGTGGCAGGATTGAGATTTCTCGAGAAATCTCAATCCTGCCACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178820.3-407s21c1
Sequence:CCGGCCCATCGGACGCAACCTTATTCTCGAGAATAAGGTTGCGTCCGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178820.3-688s21c1
Sequence:CCGGCAGACTCCTCGTCCAACTTCTCTCGAGAGAAGTTGGACGAGGAGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369047    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178820.3-1090s21c1
Sequence:CCGGAGGTTCTAGAAACTACCAGAACTCGAGTTCTGGTAGTTTCTAGAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369105    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_178820.3-1312s21c1
Sequence:CCGGCTGACCTCTTGTCTCCTATTGCTCGAGCAATAGGAGACAAGAGGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007792    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178820.3-1387s1c1
Sequence:CCGGGAACTTAGAATCTCATCCTTACTCGAGTAAGGATGAGATTCTAAGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178820.3-796s1c1
Sequence:CCGGCCACGTGTTCTCCAACATCAACTCGAGTTGATGTTGGAGAACACGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_178820.3-714s1c1
Sequence:CCGGCCAACCAGACTGTTCTAGATACTCGAGTATCTAGAACAGTCTGGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178820.3-767s1c1
Sequence:CCGGTGGAACAACAATGCCTGCCTTCTCGAGAAGGCAGGCATTGTTGTTCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_178820.3-535s1c1
Sequence:CCGGGACGTGCTTCGTGACTTCATTCTCGAGAATGAAGTCACGAAGCACGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178820
VALIDATED
FBXO27 MISSION shRNA Lentiviral Transduction Particles
F-box protein 27
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000376403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178820.3-536s21c1
Sequence:CCGGACGTGCTTCGTGACTTCATTCCTCGAGGAATGAAGTCACGAAGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_178820.3-826s21c1
Sequence:CCGGCCGCTTTGTGTCTTTCGAACACTCGAGTGTTCGAAAGACACAAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_178820.3-621s21c1
Sequence:CCGGATAGTGGCAGGATTGAGATTTCTCGAGAAATCTCAATCCTGCCACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178820.3-407s21c1
Sequence:CCGGCCCATCGGACGCAACCTTATTCTCGAGAATAAGGTTGCGTCCGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178820.3-688s21c1
Sequence:CCGGCAGACTCCTCGTCCAACTTCTCTCGAGAGAAGTTGGACGAGGAGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369047    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178820.3-1090s21c1
Sequence:CCGGAGGTTCTAGAAACTACCAGAACTCGAGTTCTGGTAGTTTCTAGAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369105    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_178820.3-1312s21c1
Sequence:CCGGCTGACCTCTTGTCTCCTATTGCTCGAGCAATAGGAGACAAGAGGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007792    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178820.3-1387s1c1
Sequence:CCGGGAACTTAGAATCTCATCCTTACTCGAGTAAGGATGAGATTCTAAGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178820.3-796s1c1
Sequence:CCGGCCACGTGTTCTCCAACATCAACTCGAGTTGATGTTGGAGAACACGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_178820.3-714s1c1
Sequence:CCGGCCAACCAGACTGTTCTAGATACTCGAGTATCTAGAACAGTCTGGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178820.3-767s1c1
Sequence:CCGGTGGAACAACAATGCCTGCCTTCTCGAGAAGGCAGGCATTGTTGTTCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_178820.3-535s1c1
Sequence:CCGGGACGTGCTTCGTGACTTCATTCTCGAGAATGAAGTCACGAAGCACGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207238
FBXO27 MISSION shRNA Bacterial Glycerol Stock
F-box protein 27
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000092043    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207238.1-1739s1c1
Sequence:CCGGCCTCCTCATTGAAGGGTGTTTCTCGAGAAACACCCTTCAATGAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207238.1-747s1c1
Sequence:CCGGCGTCTCTTTGTCACGCTTCTTCTCGAGAAGAAGCGTGACAAAGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207238.1-773s1c1
Sequence:CCGGCCACCAGAACGTCATAGATAACTCGAGTTATCTATGACGTTCTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207238.1-776s1c1
Sequence:CCGGCCAGAACGTCATAGATAAGTTCTCGAGAACTTATCTATGACGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207238
FBXO27 MISSION shRNA shRNA Plasmid DNA
F-box protein 27
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000092043    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207238.1-1739s1c1
Sequence:CCGGCCTCCTCATTGAAGGGTGTTTCTCGAGAAACACCCTTCAATGAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207238.1-747s1c1
Sequence:CCGGCGTCTCTTTGTCACGCTTCTTCTCGAGAAGAAGCGTGACAAAGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207238.1-773s1c1
Sequence:CCGGCCACCAGAACGTCATAGATAACTCGAGTTATCTATGACGTTCTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207238.1-776s1c1
Sequence:CCGGCCAGAACGTCATAGATAAGTTCTCGAGAACTTATCTATGACGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207238
FBXO27 MISSION shRNA Lentiviral Transduction Particles
F-box protein 27
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000092043    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207238.1-1739s1c1
Sequence:CCGGCCTCCTCATTGAAGGGTGTTTCTCGAGAAACACCCTTCAATGAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207238.1-747s1c1
Sequence:CCGGCGTCTCTTTGTCACGCTTCTTCTCGAGAAGAAGCGTGACAAAGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207238.1-773s1c1
Sequence:CCGGCCACCAGAACGTCATAGATAACTCGAGTTATCTATGACGTTCTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207238.1-776s1c1
Sequence:CCGGCCAGAACGTCATAGATAAGTTCTCGAGAACTTATCTATGACGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks