EMAIL THIS PAGE TO A FRIEND

FBXO28

F-box protein 28

Synonyms: CENP-30 Fbx28
UniProtKB ID: Q9NVF7, E9PEM8, O75070
Gene ID:
Human(23219) Summary: Members of the F-box protein family, such as FBXO28, are characterized by an approximately 40-amino acid F-box motif. SCF complexes, formed by SKP1 (MIM 601434), cullin (see CUL1; MIM 603134), and F-box proteins, act as protein-ubiquitin ligases. F-box proteins interact with SKP1 through the F box, and they interact with ubiquitination targets through other protein interaction domains (Jin et al., 2004 [PubMed 15520277]
Mouse(67948) F-box protein 28
Rat(305105) F-box protein 28
naked mole-rat(101722656) F-box protein 28
sheep(101103583) F-box protein 28
Zebrafish(556288) F-box protein 28
chicken(421328) F-box protein 28
dog(612012) F-box protein 28
cow(537745) F-box protein 28
domestic cat(101083733) F-box protein 28
174 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015176 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015176 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015176 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175127 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175127 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175127 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015176 Rosetta Predictions human pricing
NM_001107203 Rosetta Predictions rat pricing
NM_175127 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015176 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00055352 predicted 752
2 SASI_Hs02_00347200 predicted 410
3 SASI_Hs01_00055354 predicted 802
4 SASI_Hs01_00055355 predicted 462
5 SASI_Hs01_00055356 predicted 634
6 SASI_Hs01_00055357 predicted 1159
7 SASI_Hs02_00347201 predicted 1085
8 SASI_Hs01_00055358 predicted 846
9 SASI_Hs01_00055359 predicted 1166
10 SASI_Hs01_00055360 predicted 456
11 SASI_Hs01_00055353 predicted 1198
12 SASI_Hs01_00055361 predicted 1221
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107203 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00226525 predicted 1069
2 SASI_Rn02_00226526 predicted 553
3 SASI_Rn02_00226527 predicted 242
4 SASI_Rn02_00226528 predicted 318
5 SASI_Rn02_00226529 predicted 351
6 SASI_Rn02_00226530 predicted 617
7 SASI_Rn02_00226531 predicted 994
8 SASI_Rn02_00226532 predicted 1083
9 SASI_Rn02_00226533 predicted 538
10 SASI_Rn02_00226534 predicted 227
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175127 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00067447 predicted 557
2 SASI_Mm01_00067448 predicted 408
3 SASI_Mm01_00067450 predicted 670
4 SASI_Mm02_00345741 predicted 749
5 SASI_Mm01_00067452 predicted 620
6 SASI_Mm01_00067453 predicted 536
7 SASI_Mm01_00067454 predicted 937
8 SASI_Mm01_00067455 predicted 232
9 SASI_Mm01_00067456 predicted 1187
10 SASI_Mm02_00345742 predicted 287
11 SASI_Mm01_00067449 predicted 1082
12 SASI_Mm01_00067451 predicted 1179
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015176
VALIDATED
FBXO28 MISSION shRNA Bacterial Glycerol Stock
F-box protein 28
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000147607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015176.1-316s1c1
Sequence:CCGGGAGAATGTTGAATCAGGGATTCTCGAGAATCCCTGATTCAACATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015176.1-971s1c1
Sequence:CCGGGCAGAGCTAGAACGCAAACTACTCGAGTAGTTTGCGTTCTAGCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180342    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015176.1-437s1c1
Sequence:CCGGGCAGACATTCTTGCTGCTGTTCTCGAGAACAGCAGCAAGAATGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435936    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015176.2-1456s21c1
Sequence:CCGGTACATACGTAAGGATCTTAAACTCGAGTTTAAGATCCTTACGTATGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015176.2-1121s21c1
Sequence:CCGGATCTAAACGTCTTCGGAATAGCTCGAGCTATTCCGAAGACGTTTAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015176.1-252s1c1
Sequence:CCGGTTATGTCCTACGACGAAATTACTCGAGTAATTTCGTCGTAGGACATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219801    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015176.1-1971s1c1
Sequence:CCGGTAGGAACAAGAGACTATTAAACTCGAGTTTAATAGTCTCTTGTTCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412345    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015176.2-1185s21c1
Sequence:CCGGCTTAGTAGCTTAAGCAGTTATCTCGAGATAACTGCTTAAGCTACTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015176
VALIDATED
FBXO28 MISSION shRNA shRNA Plasmid DNA
F-box protein 28
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000147607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015176.1-316s1c1
Sequence:CCGGGAGAATGTTGAATCAGGGATTCTCGAGAATCCCTGATTCAACATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015176.1-971s1c1
Sequence:CCGGGCAGAGCTAGAACGCAAACTACTCGAGTAGTTTGCGTTCTAGCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180342    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015176.1-437s1c1
Sequence:CCGGGCAGACATTCTTGCTGCTGTTCTCGAGAACAGCAGCAAGAATGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435936    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015176.2-1456s21c1
Sequence:CCGGTACATACGTAAGGATCTTAAACTCGAGTTTAAGATCCTTACGTATGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015176.2-1121s21c1
Sequence:CCGGATCTAAACGTCTTCGGAATAGCTCGAGCTATTCCGAAGACGTTTAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015176.1-252s1c1
Sequence:CCGGTTATGTCCTACGACGAAATTACTCGAGTAATTTCGTCGTAGGACATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219801    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015176.1-1971s1c1
Sequence:CCGGTAGGAACAAGAGACTATTAAACTCGAGTTTAATAGTCTCTTGTTCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412345    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015176.2-1185s21c1
Sequence:CCGGCTTAGTAGCTTAAGCAGTTATCTCGAGATAACTGCTTAAGCTACTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015176
VALIDATED
FBXO28 MISSION shRNA Lentiviral Transduction Particles
F-box protein 28
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000147607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015176.1-316s1c1
Sequence:CCGGGAGAATGTTGAATCAGGGATTCTCGAGAATCCCTGATTCAACATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015176.1-971s1c1
Sequence:CCGGGCAGAGCTAGAACGCAAACTACTCGAGTAGTTTGCGTTCTAGCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180342    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015176.1-437s1c1
Sequence:CCGGGCAGACATTCTTGCTGCTGTTCTCGAGAACAGCAGCAAGAATGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435936    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015176.2-1456s21c1
Sequence:CCGGTACATACGTAAGGATCTTAAACTCGAGTTTAAGATCCTTACGTATGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015176.2-1121s21c1
Sequence:CCGGATCTAAACGTCTTCGGAATAGCTCGAGCTATTCCGAAGACGTTTAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015176.1-252s1c1
Sequence:CCGGTTATGTCCTACGACGAAATTACTCGAGTAATTTCGTCGTAGGACATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219801    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015176.1-1971s1c1
Sequence:CCGGTAGGAACAAGAGACTATTAAACTCGAGTTTAATAGTCTCTTGTTCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412345    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015176.2-1185s21c1
Sequence:CCGGCTTAGTAGCTTAAGCAGTTATCTCGAGATAACTGCTTAAGCTACTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175127
VALIDATED
FBXO28 MISSION shRNA Bacterial Glycerol Stock
F-box protein 28
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175127.1-944s1c1
Sequence:CCGGCCAGATCATAGGCGAACAGAACTCGAGTTCTGTTCGCCTATGATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175127.1-466s1c1
Sequence:CCGGCGAGGTTGTCACTGTTGAATACTCGAGTATTCAACAGTGACAACCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175127.1-365s1c1
Sequence:CCGGCCTGTGTCAGAAGCAAGTTAACTCGAGTTAACTTGCTTCTGACACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175127.1-239s1c1
Sequence:CCGGCGAGAACATCCTCAGCTTTATCTCGAGATAAAGCTGAGGATGTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175127.2-233s21c1
Sequence:CCGGCGAGAACATCCTCAGCTTTATCTCGAGATAAAGCTGAGGATGTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328357    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175127.2-1381s21c1
Sequence:CCGGGGCGATGTGTTAAGGTTATTTCTCGAGAAATAACCTTAACACATCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175127.2-460s21c1
Sequence:CCGGCGAGGTTGTCACTGTTGAATACTCGAGTATTCAACAGTGACAACCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175127.2-928s21c1
Sequence:CCGGTCGAGCAGACCCAGATCATAGCTCGAGCTATGATCTGGGTCTGCTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175127
VALIDATED
FBXO28 MISSION shRNA shRNA Plasmid DNA
F-box protein 28
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175127.1-944s1c1
Sequence:CCGGCCAGATCATAGGCGAACAGAACTCGAGTTCTGTTCGCCTATGATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175127.1-466s1c1
Sequence:CCGGCGAGGTTGTCACTGTTGAATACTCGAGTATTCAACAGTGACAACCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175127.1-365s1c1
Sequence:CCGGCCTGTGTCAGAAGCAAGTTAACTCGAGTTAACTTGCTTCTGACACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175127.1-239s1c1
Sequence:CCGGCGAGAACATCCTCAGCTTTATCTCGAGATAAAGCTGAGGATGTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175127.2-233s21c1
Sequence:CCGGCGAGAACATCCTCAGCTTTATCTCGAGATAAAGCTGAGGATGTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328357    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175127.2-1381s21c1
Sequence:CCGGGGCGATGTGTTAAGGTTATTTCTCGAGAAATAACCTTAACACATCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175127.2-460s21c1
Sequence:CCGGCGAGGTTGTCACTGTTGAATACTCGAGTATTCAACAGTGACAACCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175127.2-928s21c1
Sequence:CCGGTCGAGCAGACCCAGATCATAGCTCGAGCTATGATCTGGGTCTGCTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175127
VALIDATED
FBXO28 MISSION shRNA Lentiviral Transduction Particles
F-box protein 28
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175127.1-944s1c1
Sequence:CCGGCCAGATCATAGGCGAACAGAACTCGAGTTCTGTTCGCCTATGATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175127.1-466s1c1
Sequence:CCGGCGAGGTTGTCACTGTTGAATACTCGAGTATTCAACAGTGACAACCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175127.1-365s1c1
Sequence:CCGGCCTGTGTCAGAAGCAAGTTAACTCGAGTTAACTTGCTTCTGACACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175127.1-239s1c1
Sequence:CCGGCGAGAACATCCTCAGCTTTATCTCGAGATAAAGCTGAGGATGTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175127.2-233s21c1
Sequence:CCGGCGAGAACATCCTCAGCTTTATCTCGAGATAAAGCTGAGGATGTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328357    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175127.2-1381s21c1
Sequence:CCGGGGCGATGTGTTAAGGTTATTTCTCGAGAAATAACCTTAACACATCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175127.2-460s21c1
Sequence:CCGGCGAGGTTGTCACTGTTGAATACTCGAGTATTCAACAGTGACAACCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175127.2-928s21c1
Sequence:CCGGTCGAGCAGACCCAGATCATAGCTCGAGCTATGATCTGGGTCTGCTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks