EMAIL THIS PAGE TO A FRIEND

FBXO2

F-box protein 2

61 Gene Product Result for
Synonyms: FBG1 FBX2 Fbs1 NFB42 OCP1
UniProtKB ID: Q9UK22, B2R7K7, Q5TGY0, Q6FGJ7, Q8TB29, Q9UKC6
Gene ID:
Human(26232) Summary: This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of the ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class. This protein is highly similar to the rat NFB42 (neural F Box 42 kDa) protein which is enriched in the nervous system and may play a role in maintaining neurons in a postmitotic state. [provided by RefSeq, Jul 2008]
Mouse(230904) F-box protein 2
Rat(85273) F-box protein 2
chicken(419495) F-box protein 2
domestic cat(101099135) F-box protein 2
cow(512589) F-box protein 2
dog(478231) F-box protein 2
naked mole-rat(101721920) F-box protein 2
sheep(101112079) F-box protein 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012168 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012168 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012168 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_176848 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_176848 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_176848 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012168 Rosetta Predictions human pricing
NM_053511 Rosetta Predictions rat pricing
NM_176848 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012168 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00163624 predicted 1001
2 SASI_Hs01_00163625 predicted 997
3 SASI_Hs01_00163626 predicted 979
4 SASI_Hs02_00343768 predicted 671
5 SASI_Hs01_00163627 predicted 977
6 SASI_Hs01_00163628 predicted 1161
7 SASI_Hs01_00163629 predicted 979
8 SASI_Hs01_00163630 predicted 1104
9 SASI_Hs01_00163631 predicted 852
10 SASI_Hs01_00163632 predicted 877
11 SASI_Hs01_00163633 predicted 856
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053511 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00096503 predicted 975
2 SASI_Rn01_00096504 predicted 1009
3 SASI_Rn01_00096505 predicted 986
4 SASI_Rn01_00096506 predicted 726
5 SASI_Rn01_00096507 predicted 993
6 SASI_Rn01_00096508 predicted 712
7 SASI_Rn01_00096509 predicted 400
8 SASI_Rn01_00096510 predicted 757
9 SASI_Rn01_00096511 predicted 599
10 SASI_Rn01_00096512 predicted 966
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176848 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00082215 predicted 660
2 SASI_Mm01_00082216 predicted 963
3 SASI_Mm01_00082219 predicted 686
4 SASI_Mm01_00082221 predicted 507
5 SASI_Mm02_00346757 predicted 511
6 SASI_Mm02_00346758 predicted 643
7 SASI_Mm02_00346759 predicted 355
8 SASI_Mm01_00082224 predicted 556
9 SASI_Mm02_00346760 predicted 641
10 SASI_Mm02_00346761 predicted 651
11 SASI_Mm01_00082217 predicted 940
12 SASI_Mm01_00082218 predicted 479
13 SASI_Mm01_00082220 predicted 363
14 SASI_Mm01_00082222 predicted 572
15 SASI_Mm01_00082223 predicted 359
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012168
VALIDATED
FBXO2 MISSION shRNA Bacterial Glycerol Stock
F-box protein 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_012168.x-1098s1c1
Sequence:CCGGGATCTCCCACACCTTCACCGACTCGAGTCGGTGAAGGTGTGGGAGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_012168.x-748s1c1
Sequence:CCGGTGGTGTGACGTGGAGCATGGTCTCGAGACCATGCTCCACGTCACACCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004305    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_012168.x-1502s1c1
Sequence:CCGGACAAAGTGGGCTCTCAATAAACTCGAGTTTATTGAGAGCCCACTTTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_012168.x-944s1c1
Sequence:CCGGTCGTGGTGAAGGACTGGTACTCTCGAGAGTACCAGTCCTTCACCACGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_012168.x-999s1c1
Sequence:CCGGCACCGTTAAGCTACTGTCCGACTCGAGTCGGACAGTAGCTTAACGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012168.4-1208s21c1
Sequence:CCGGACAGCAGCGTGTGGGTAGAACCTCGAGGTTCTACCCACACGCTGCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012168.4-830s21c1
Sequence:CCGGAGAGCGTCAAGAAGTACTTCGCTCGAGCGAAGTACTTCTTGACGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012168.4-869s21c1
Sequence:CCGGGTCGCAAAGCACAGGTCATTGCTCGAGCAATGACCTGTGCTTTGCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417437    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012168.4-1272s21c1
Sequence:CCGGGCAAAGGTCGAGGGTAGATAGCTCGAGCTATCTACCCTCGACCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012168
VALIDATED
FBXO2 MISSION shRNA shRNA Plasmid DNA
F-box protein 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_012168.x-1098s1c1
Sequence:CCGGGATCTCCCACACCTTCACCGACTCGAGTCGGTGAAGGTGTGGGAGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_012168.x-748s1c1
Sequence:CCGGTGGTGTGACGTGGAGCATGGTCTCGAGACCATGCTCCACGTCACACCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004305    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_012168.x-1502s1c1
Sequence:CCGGACAAAGTGGGCTCTCAATAAACTCGAGTTTATTGAGAGCCCACTTTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_012168.x-944s1c1
Sequence:CCGGTCGTGGTGAAGGACTGGTACTCTCGAGAGTACCAGTCCTTCACCACGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_012168.x-999s1c1
Sequence:CCGGCACCGTTAAGCTACTGTCCGACTCGAGTCGGACAGTAGCTTAACGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012168.4-1208s21c1
Sequence:CCGGACAGCAGCGTGTGGGTAGAACCTCGAGGTTCTACCCACACGCTGCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012168.4-830s21c1
Sequence:CCGGAGAGCGTCAAGAAGTACTTCGCTCGAGCGAAGTACTTCTTGACGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012168.4-869s21c1
Sequence:CCGGGTCGCAAAGCACAGGTCATTGCTCGAGCAATGACCTGTGCTTTGCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417437    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012168.4-1272s21c1
Sequence:CCGGGCAAAGGTCGAGGGTAGATAGCTCGAGCTATCTACCCTCGACCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012168
VALIDATED
FBXO2 MISSION shRNA Lentiviral Transduction Particles
F-box protein 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_012168.x-1098s1c1
Sequence:CCGGGATCTCCCACACCTTCACCGACTCGAGTCGGTGAAGGTGTGGGAGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_012168.x-748s1c1
Sequence:CCGGTGGTGTGACGTGGAGCATGGTCTCGAGACCATGCTCCACGTCACACCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004305    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_012168.x-1502s1c1
Sequence:CCGGACAAAGTGGGCTCTCAATAAACTCGAGTTTATTGAGAGCCCACTTTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_012168.x-944s1c1
Sequence:CCGGTCGTGGTGAAGGACTGGTACTCTCGAGAGTACCAGTCCTTCACCACGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_012168.x-999s1c1
Sequence:CCGGCACCGTTAAGCTACTGTCCGACTCGAGTCGGACAGTAGCTTAACGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012168.4-1208s21c1
Sequence:CCGGACAGCAGCGTGTGGGTAGAACCTCGAGGTTCTACCCACACGCTGCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012168.4-830s21c1
Sequence:CCGGAGAGCGTCAAGAAGTACTTCGCTCGAGCGAAGTACTTCTTGACGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012168.4-869s21c1
Sequence:CCGGGTCGCAAAGCACAGGTCATTGCTCGAGCAATGACCTGTGCTTTGCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417437    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012168.4-1272s21c1
Sequence:CCGGGCAAAGGTCGAGGGTAGATAGCTCGAGCTATCTACCCTCGACCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_176848
FBXO2 MISSION shRNA Bacterial Glycerol Stock
F-box protein 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000087086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176848.1-513s1c1
Sequence:CCGGCCCAAGATGACAGCGTTAAGACTCGAGTCTTAACGCTGTCATCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176848.1-514s1c1
Sequence:CCGGCCAAGATGACAGCGTTAAGAACTCGAGTTCTTAACGCTGTCATCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176848.1-358s1c1
Sequence:CCGGCCACTGGCAACAGTTCTACTTCTCGAGAAGTAGAACTGTTGCCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087083    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176848.1-1078s1c1
Sequence:CCGGGCTTTACTGTAGGATGGCTTTCTCGAGAAAGCCATCCTACAGTAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176848.1-525s1c1
Sequence:CCGGGCGTTAAGAAATACTTCGCCTCTCGAGAGGCGAAGTATTTCTTAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_176848
FBXO2 MISSION shRNA shRNA Plasmid DNA
F-box protein 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000087086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176848.1-513s1c1
Sequence:CCGGCCCAAGATGACAGCGTTAAGACTCGAGTCTTAACGCTGTCATCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176848.1-514s1c1
Sequence:CCGGCCAAGATGACAGCGTTAAGAACTCGAGTTCTTAACGCTGTCATCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176848.1-358s1c1
Sequence:CCGGCCACTGGCAACAGTTCTACTTCTCGAGAAGTAGAACTGTTGCCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087083    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176848.1-1078s1c1
Sequence:CCGGGCTTTACTGTAGGATGGCTTTCTCGAGAAAGCCATCCTACAGTAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176848.1-525s1c1
Sequence:CCGGGCGTTAAGAAATACTTCGCCTCTCGAGAGGCGAAGTATTTCTTAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_176848
FBXO2 MISSION shRNA Lentiviral Transduction Particles
F-box protein 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000087086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176848.1-513s1c1
Sequence:CCGGCCCAAGATGACAGCGTTAAGACTCGAGTCTTAACGCTGTCATCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176848.1-514s1c1
Sequence:CCGGCCAAGATGACAGCGTTAAGAACTCGAGTTCTTAACGCTGTCATCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176848.1-358s1c1
Sequence:CCGGCCACTGGCAACAGTTCTACTTCTCGAGAAGTAGAACTGTTGCCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087083    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176848.1-1078s1c1
Sequence:CCGGGCTTTACTGTAGGATGGCTTTCTCGAGAAAGCCATCCTACAGTAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176848.1-525s1c1
Sequence:CCGGGCGTTAAGAAATACTTCGCCTCTCGAGAGGCGAAGTATTTCTTAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks