EMAIL THIS PAGE TO A FRIEND

FBXO30

F-box protein 30

171 Gene Product Result for
Synonyms: Fbx30
UniProtKB ID: Q8TB52, Q9BXZ7
Gene ID:
Human(84085) Summary: This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of the ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class and it is upregulated in nasopharyngeal carcinoma. [provided by RefSeq, Jul 2008]
Mouse(71865) F-box protein 30
Rat(308283) F-box protein 30
naked mole-rat(101715200) F-box protein 30
sheep(101120415) F-box protein 30
chicken(421612) F-box protein 30
cow(539435) F-box protein 30
domestic cat(101093611) F-box protein 30
Horse(100066297) F-box protein 30
dog(484023) F-box protein 30
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032145 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032145 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032145 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027968 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027968 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027968 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032145 Rosetta Predictions human pricing
NM_001007690 Rosetta Predictions rat pricing
NM_027968 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032145 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00359376 predicted 1762
2 SASI_Hs01_00203249 predicted 2236
3 SASI_Hs01_00203251 predicted 478
4 SASI_Hs01_00203252 predicted 1878
5 SASI_Hs02_00359377 predicted 1024
6 SASI_Hs01_00203253 predicted 2085
7 SASI_Hs01_00203255 predicted 689
8 SASI_Hs02_00359378 predicted 208
9 SASI_Hs01_00203256 predicted 1981
10 SASI_Hs01_00203257 predicted 1926
11 SASI_Hs01_00203250 predicted 587
12 SASI_Hs01_00203254 predicted 1645
13 SASI_Hs01_00203258 predicted 1324
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007690 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00050933 predicted 658
2 SASI_Rn01_00050934 predicted 1064
3 SASI_Rn02_00198841 predicted 784
4 SASI_Rn01_00050936 predicted 410
5 SASI_Rn01_00050937 predicted 873
6 SASI_Rn02_00198842 predicted 1900
7 SASI_Rn02_00198843 predicted 1882
8 SASI_Rn01_00050938 predicted 374
9 SASI_Rn01_00050939 predicted 1009
10 SASI_Rn01_00050940 predicted 2279
11 SASI_Rn01_00050935 predicted 952
12 SASI_Rn01_00050941 predicted 1845
13 SASI_Rn01_00050942 predicted 1498
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027968 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00056757 predicted 2468
2 SASI_Mm01_00056758 predicted 642
3 SASI_Mm02_00333003 predicted 919
4 SASI_Mm01_00056761 predicted 1273
5 SASI_Mm01_00056762 predicted 423
6 SASI_Mm01_00056763 predicted 1588
7 SASI_Mm01_00056765 predicted 342
8 SASI_Mm02_00333004 predicted 2376
9 SASI_Mm02_00333005 predicted 754
10 SASI_Mm02_00333006 predicted 1868
11 SASI_Mm01_00056759 predicted 2423
12 SASI_Mm01_00056760 predicted 2177
13 SASI_Mm01_00056764 predicted 2087
14 SASI_Mm01_00056766 predicted 2266
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032145
FBXO30 MISSION shRNA Bacterial Glycerol Stock
F-box protein 30
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032145.3-381s1c1
Sequence:CCGGGCCCGAAATAAAGTTGCTGAACTCGAGTTCAGCAACTTTATTTCGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032145.3-1831s1c1
Sequence:CCGGGCCCTTTAGCTTACTATGGTTCTCGAGAACCATAGTAAGCTAAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032145.3-1852s1c1
Sequence:CCGGGTACCTATTCTCAGCGTAGATCTCGAGATCTACGCTGAGAATAGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032145.3-1709s1c1
Sequence:CCGGGCAGCGTTCAATGTTTACCTTCTCGAGAAGGTAAACATTGAACGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032145.3-431s1c1
Sequence:CCGGGTGCTGTACTATGGAATGGAACTCGAGTTCCATTCCATAGTACAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032145.4-2106s21c1
Sequence:CCGGTCTCATGTGTATCCAAGTTAACTCGAGTTAACTTGGATACACATGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032145.4-539s21c1
Sequence:CCGGGTCGATGAAGTGGCACAATTGCTCGAGCAATTGTGCCACTTCATCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032145
FBXO30 MISSION shRNA shRNA Plasmid DNA
F-box protein 30
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032145.3-381s1c1
Sequence:CCGGGCCCGAAATAAAGTTGCTGAACTCGAGTTCAGCAACTTTATTTCGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032145.3-1831s1c1
Sequence:CCGGGCCCTTTAGCTTACTATGGTTCTCGAGAACCATAGTAAGCTAAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032145.3-1852s1c1
Sequence:CCGGGTACCTATTCTCAGCGTAGATCTCGAGATCTACGCTGAGAATAGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032145.3-1709s1c1
Sequence:CCGGGCAGCGTTCAATGTTTACCTTCTCGAGAAGGTAAACATTGAACGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032145.3-431s1c1
Sequence:CCGGGTGCTGTACTATGGAATGGAACTCGAGTTCCATTCCATAGTACAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032145.4-2106s21c1
Sequence:CCGGTCTCATGTGTATCCAAGTTAACTCGAGTTAACTTGGATACACATGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032145.4-539s21c1
Sequence:CCGGGTCGATGAAGTGGCACAATTGCTCGAGCAATTGTGCCACTTCATCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032145
FBXO30 MISSION shRNA Lentiviral Transduction Particles
F-box protein 30
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032145.3-381s1c1
Sequence:CCGGGCCCGAAATAAAGTTGCTGAACTCGAGTTCAGCAACTTTATTTCGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032145.3-1831s1c1
Sequence:CCGGGCCCTTTAGCTTACTATGGTTCTCGAGAACCATAGTAAGCTAAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032145.3-1852s1c1
Sequence:CCGGGTACCTATTCTCAGCGTAGATCTCGAGATCTACGCTGAGAATAGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032145.3-1709s1c1
Sequence:CCGGGCAGCGTTCAATGTTTACCTTCTCGAGAAGGTAAACATTGAACGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032145.3-431s1c1
Sequence:CCGGGTGCTGTACTATGGAATGGAACTCGAGTTCCATTCCATAGTACAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032145.4-2106s21c1
Sequence:CCGGTCTCATGTGTATCCAAGTTAACTCGAGTTAACTTGGATACACATGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032145.4-539s21c1
Sequence:CCGGGTCGATGAAGTGGCACAATTGCTCGAGCAATTGTGCCACTTCATCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027968
VALIDATED
FBXO30 MISSION shRNA Bacterial Glycerol Stock
F-box protein 30
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000193100    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027968.1-441s1c2
Sequence:CCGGCGTTAGTTATTCAGACCGGAACTCGAGTTCCGGTCTGAATAACTAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174917    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027968.1-3061s1c1
Sequence:CCGGGCCTGTGAATTTAACTTGAAACTCGAGTTTCAAGTTAAATTCACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027968.2-1833s21c1
Sequence:CCGGACCTATTCTCAGCGTAGATTTCTCGAGAAATCTACGCTGAGAATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027968.2-1806s21c1
Sequence:CCGGAGGTGTCCTTTAGCTTATTATCTCGAGATAATAAGCTAAAGGACACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251383    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027968.2-3155s21c1
Sequence:CCGGTGGAATATTGTTCGAATAAACCTCGAGGTTTATTCGAACAATATTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217938    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027968.2-486s1c1
Sequence:CCGGGTTGATGAAGTGGCACAATTACTCGAGTAATTGTGCCACTTCATCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027968.2-1887s21c1
Sequence:CCGGGATCGCCATTTAAGGTCATTTCTCGAGAAATGACCTTAAATGGCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027968.2-351s21c1
Sequence:CCGGTTTACCCTGGCACGAAATAAACTCGAGTTTATTTCGTGCCAGGGTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027968
VALIDATED
FBXO30 MISSION shRNA shRNA Plasmid DNA
F-box protein 30
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000193100    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027968.1-441s1c2
Sequence:CCGGCGTTAGTTATTCAGACCGGAACTCGAGTTCCGGTCTGAATAACTAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174917    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027968.1-3061s1c1
Sequence:CCGGGCCTGTGAATTTAACTTGAAACTCGAGTTTCAAGTTAAATTCACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027968.2-1833s21c1
Sequence:CCGGACCTATTCTCAGCGTAGATTTCTCGAGAAATCTACGCTGAGAATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027968.2-1806s21c1
Sequence:CCGGAGGTGTCCTTTAGCTTATTATCTCGAGATAATAAGCTAAAGGACACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251383    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027968.2-3155s21c1
Sequence:CCGGTGGAATATTGTTCGAATAAACCTCGAGGTTTATTCGAACAATATTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217938    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027968.2-486s1c1
Sequence:CCGGGTTGATGAAGTGGCACAATTACTCGAGTAATTGTGCCACTTCATCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027968.2-1887s21c1
Sequence:CCGGGATCGCCATTTAAGGTCATTTCTCGAGAAATGACCTTAAATGGCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027968.2-351s21c1
Sequence:CCGGTTTACCCTGGCACGAAATAAACTCGAGTTTATTTCGTGCCAGGGTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027968
VALIDATED
FBXO30 MISSION shRNA Lentiviral Transduction Particles
F-box protein 30
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000193100    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027968.1-441s1c2
Sequence:CCGGCGTTAGTTATTCAGACCGGAACTCGAGTTCCGGTCTGAATAACTAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174917    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027968.1-3061s1c1
Sequence:CCGGGCCTGTGAATTTAACTTGAAACTCGAGTTTCAAGTTAAATTCACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027968.2-1833s21c1
Sequence:CCGGACCTATTCTCAGCGTAGATTTCTCGAGAAATCTACGCTGAGAATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027968.2-1806s21c1
Sequence:CCGGAGGTGTCCTTTAGCTTATTATCTCGAGATAATAAGCTAAAGGACACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251383    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027968.2-3155s21c1
Sequence:CCGGTGGAATATTGTTCGAATAAACCTCGAGGTTTATTCGAACAATATTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217938    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027968.2-486s1c1
Sequence:CCGGGTTGATGAAGTGGCACAATTACTCGAGTAATTGTGCCACTTCATCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027968.2-1887s21c1
Sequence:CCGGGATCGCCATTTAAGGTCATTTCTCGAGAAATGACCTTAAATGGCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027968.2-351s21c1
Sequence:CCGGTTTACCCTGGCACGAAATAAACTCGAGTTTATTTCGTGCCAGGGTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks