EMAIL THIS PAGE TO A FRIEND

FBXO31

F-box protein 31

74 Gene Product Result for
Synonyms: FBX14 FBXO14 Fbx31 pp2386
UniProtKB ID: Q5XUX0, Q5K680, Q8WYV1, Q96D73, Q9UFV4
Gene ID:
Human(79791) Summary: Members of the F-box protein family, such as FBXO31, are characterized by an approximately 40-amino acid F-box motif. SCF complexes, formed by SKP1 (MIM 601434), cullin (see CUL1; MIM 603134), and F-box proteins, act as protein-ubiquitin ligases. F-box proteins interact with SKP1 through the F box, and they interact with ubiquitination targets through other protein interaction domains (Jin et al., 2004 [PubMed 15520277]
Mouse(76454) F-box protein 31
Rat(498959) F-box protein 31
chicken(415828) F-box protein 31
dog(479620) F-box protein 31
Horse(100070571) F-box protein 31
cow(513951) F-box protein 31
domestic cat(101095458) F-box protein 31
sheep(101104521) F-box protein 31
Domestic Rabbit(100349211) F-box protein 31
naked mole-rat(101708615) F-box protein 31
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024735 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024735 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024735 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133765 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133765 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133765 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024735 Rosetta Predictions human pricing
NM_001044259 Rosetta Predictions rat pricing
NM_133765 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024735 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00169955 predicted 819
2 SASI_Hs01_00169956 predicted 429
3 SASI_Hs01_00169958 predicted 1879
4 SASI_Hs01_00169959 predicted 1403
5 SASI_Hs01_00169960 predicted 825
6 SASI_Hs02_00357210 predicted 931
7 SASI_Hs02_00357211 predicted 635
8 SASI_Hs01_00169962 predicted 556
9 SASI_Hs01_00169963 predicted 572
10 SASI_Hs02_00357212 predicted 1807
11 SASI_Hs01_00169957 predicted 1724
12 SASI_Hs01_00169961 predicted 593
13 SASI_Hs01_00169964 predicted 1818
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001044259 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00205297 predicted 1469
2 SASI_Rn02_00205298 predicted 447
3 SASI_Rn02_00205299 predicted 867
4 SASI_Rn02_00205300 predicted 1143
5 SASI_Rn02_00205301 predicted 968
6 SASI_Rn02_00205302 predicted 871
7 SASI_Rn02_00205303 predicted 1406
8 SASI_Rn02_00205304 predicted 680
9 SASI_Rn02_00205305 predicted 873
10 SASI_Rn02_00205306 predicted 1433
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133765 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00159180 predicted 671
2 SASI_Mm02_00338767 predicted 388
3 SASI_Mm01_00159183 predicted 1338
4 SASI_Mm01_00159182 predicted 676
5 SASI_Mm01_00159184 predicted 809
6 SASI_Mm01_00159185 predicted 908
7 SASI_Mm01_00159186 predicted 620
8 SASI_Mm01_00159187 predicted 812
9 SASI_Mm01_00159189 predicted 1209
10 SASI_Mm02_00338768 predicted 854
11 SASI_Mm01_00159181 predicted 1317
12 SASI_Mm01_00159188 predicted 637
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024735
VALIDATED
FBXO31 MISSION shRNA Bacterial Glycerol Stock
F-box protein 31
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024735.3-450s21c1
Sequence:CCGGGCGAAGCTGCTTCACCGATATCTCGAGATATCGGTGAAGCAGCTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024735.3-658s21c1
Sequence:CCGGAGTGCATGTACGGCCACAAAGCTCGAGCTTTGTGGCCGTACATGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433748    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024735.3-1868s21c1
Sequence:CCGGAGCTGAGCATGTCTTACCAAACTCGAGTTTGGTAAGACATGCTCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412340    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024735.3-1827s21c1
Sequence:CCGGGTGACATAGACCTGCATATTTCTCGAGAAATATGCAGGTCTATGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024735.2-680s1c1
Sequence:CCGGGATTGTGAAGAAGGATGAGTTCTCGAGAACTCATCCTTCTTCACAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142835    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_024735.2-2576s1c1
Sequence:CCGGCCATATGAGATGACGAGGAAACTCGAGTTTCCTCGTCATCTCATATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024735.2-575s1c1
Sequence:CCGGCCCTATGAGATTCAAGCCTCTCTCGAGAGAGGCTTGAATCTCATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024735.2-1613s1c1
Sequence:CCGGGCTCAAGAACATTCAGTCCCTCTCGAGAGGGACTGAATGTTCTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024735.2-689s1c1
Sequence:CCGGGAAGGATGAGTTCTCCACCAACTCGAGTTGGTGGAGAACTCATCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024735.2-1529s1c1
Sequence:CCGGGCTGAAATCCTTCAGCCTGTACTCGAGTACAGGCTGAAGGATTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122047    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_024735.2-3433s1c1
Sequence:CCGGCCTTGAAGATTCACCATTGTTCTCGAGAACAATGGTGAATCTTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122638    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024735.2-3081s1c1
Sequence:CCGGGCCTCAGTGCATTTGGCAAATCTCGAGATTTGCCAAATGCACTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_024735.2-842s1c1
Sequence:CCGGGTTCATCTACACCAGTCAGTACTCGAGTACTGACTGGTGTAGATGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024735
VALIDATED
FBXO31 MISSION shRNA shRNA Plasmid DNA
F-box protein 31
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024735.3-450s21c1
Sequence:CCGGGCGAAGCTGCTTCACCGATATCTCGAGATATCGGTGAAGCAGCTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024735.3-658s21c1
Sequence:CCGGAGTGCATGTACGGCCACAAAGCTCGAGCTTTGTGGCCGTACATGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433748    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024735.3-1868s21c1
Sequence:CCGGAGCTGAGCATGTCTTACCAAACTCGAGTTTGGTAAGACATGCTCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412340    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024735.3-1827s21c1
Sequence:CCGGGTGACATAGACCTGCATATTTCTCGAGAAATATGCAGGTCTATGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024735.2-680s1c1
Sequence:CCGGGATTGTGAAGAAGGATGAGTTCTCGAGAACTCATCCTTCTTCACAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142835    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_024735.2-2576s1c1
Sequence:CCGGCCATATGAGATGACGAGGAAACTCGAGTTTCCTCGTCATCTCATATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024735.2-575s1c1
Sequence:CCGGCCCTATGAGATTCAAGCCTCTCTCGAGAGAGGCTTGAATCTCATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024735.2-1613s1c1
Sequence:CCGGGCTCAAGAACATTCAGTCCCTCTCGAGAGGGACTGAATGTTCTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024735.2-689s1c1
Sequence:CCGGGAAGGATGAGTTCTCCACCAACTCGAGTTGGTGGAGAACTCATCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024735.2-1529s1c1
Sequence:CCGGGCTGAAATCCTTCAGCCTGTACTCGAGTACAGGCTGAAGGATTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122047    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_024735.2-3433s1c1
Sequence:CCGGCCTTGAAGATTCACCATTGTTCTCGAGAACAATGGTGAATCTTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122638    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024735.2-3081s1c1
Sequence:CCGGGCCTCAGTGCATTTGGCAAATCTCGAGATTTGCCAAATGCACTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_024735.2-842s1c1
Sequence:CCGGGTTCATCTACACCAGTCAGTACTCGAGTACTGACTGGTGTAGATGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024735
VALIDATED
FBXO31 MISSION shRNA Lentiviral Transduction Particles
F-box protein 31
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024735.3-450s21c1
Sequence:CCGGGCGAAGCTGCTTCACCGATATCTCGAGATATCGGTGAAGCAGCTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024735.3-658s21c1
Sequence:CCGGAGTGCATGTACGGCCACAAAGCTCGAGCTTTGTGGCCGTACATGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433748    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024735.3-1868s21c1
Sequence:CCGGAGCTGAGCATGTCTTACCAAACTCGAGTTTGGTAAGACATGCTCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412340    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024735.3-1827s21c1
Sequence:CCGGGTGACATAGACCTGCATATTTCTCGAGAAATATGCAGGTCTATGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024735.2-680s1c1
Sequence:CCGGGATTGTGAAGAAGGATGAGTTCTCGAGAACTCATCCTTCTTCACAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142835    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_024735.2-2576s1c1
Sequence:CCGGCCATATGAGATGACGAGGAAACTCGAGTTTCCTCGTCATCTCATATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024735.2-575s1c1
Sequence:CCGGCCCTATGAGATTCAAGCCTCTCTCGAGAGAGGCTTGAATCTCATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024735.2-1613s1c1
Sequence:CCGGGCTCAAGAACATTCAGTCCCTCTCGAGAGGGACTGAATGTTCTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024735.2-689s1c1
Sequence:CCGGGAAGGATGAGTTCTCCACCAACTCGAGTTGGTGGAGAACTCATCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024735.2-1529s1c1
Sequence:CCGGGCTGAAATCCTTCAGCCTGTACTCGAGTACAGGCTGAAGGATTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122047    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_024735.2-3433s1c1
Sequence:CCGGCCTTGAAGATTCACCATTGTTCTCGAGAACAATGGTGAATCTTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122638    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024735.2-3081s1c1
Sequence:CCGGGCCTCAGTGCATTTGGCAAATCTCGAGATTTGCCAAATGCACTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_024735.2-842s1c1
Sequence:CCGGGTTCATCTACACCAGTCAGTACTCGAGTACTGACTGGTGTAGATGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133765
VALIDATED
FBXO31 MISSION shRNA Bacterial Glycerol Stock
F-box protein 31
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000277068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133765.3-566s21c1
Sequence:CCGGTGCGGTTCAAGCCACTGTTTACTCGAGTAAACAGTGGCTTGAACCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133765.3-1533s21c1
Sequence:CCGGCTTTGACGAGATGCTCAGGAACTCGAGTTCCTGAGCATCTCGTCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133765.3-610s21c1
Sequence:CCGGTCGGCTACAGTGGAGTGTATGCTCGAGCATACACTCCACTGTAGCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133765.3-1032s21c1
Sequence:CCGGGCAGACTGTAGAGATTGACCTCTCGAGAGGTCAATCTCTACAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277114    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133765.3-1629s21c1
Sequence:CCGGCACTTTAGAAATGAACGCACACTCGAGTGTGCGTTCATTTCTAAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133765.2-1518s1c1
Sequence:CCGGCTTTGACGAGATGCTCAGGAACTCGAGTTCCTGAGCATCTCGTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133765.2-1017s1c1
Sequence:CCGGGCAGACTGTAGAGATTGACCTCTCGAGAGGTCAATCTCTACAGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191457    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133765.2-1614s1c1
Sequence:CCGGCACTTTAGAAATGAACGCACACTCGAGTGTGCGTTCATTTCTAAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201179    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133765.2-1613s1c1
Sequence:CCGGGCACTTTAGAAATGAACGCACCTCGAGGTGCGTTCATTTCTAAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133765
VALIDATED
FBXO31 MISSION shRNA shRNA Plasmid DNA
F-box protein 31
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000277068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133765.3-566s21c1
Sequence:CCGGTGCGGTTCAAGCCACTGTTTACTCGAGTAAACAGTGGCTTGAACCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133765.3-1533s21c1
Sequence:CCGGCTTTGACGAGATGCTCAGGAACTCGAGTTCCTGAGCATCTCGTCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133765.3-610s21c1
Sequence:CCGGTCGGCTACAGTGGAGTGTATGCTCGAGCATACACTCCACTGTAGCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133765.3-1032s21c1
Sequence:CCGGGCAGACTGTAGAGATTGACCTCTCGAGAGGTCAATCTCTACAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277114    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133765.3-1629s21c1
Sequence:CCGGCACTTTAGAAATGAACGCACACTCGAGTGTGCGTTCATTTCTAAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133765.2-1518s1c1
Sequence:CCGGCTTTGACGAGATGCTCAGGAACTCGAGTTCCTGAGCATCTCGTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133765.2-1017s1c1
Sequence:CCGGGCAGACTGTAGAGATTGACCTCTCGAGAGGTCAATCTCTACAGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191457    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133765.2-1614s1c1
Sequence:CCGGCACTTTAGAAATGAACGCACACTCGAGTGTGCGTTCATTTCTAAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201179    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133765.2-1613s1c1
Sequence:CCGGGCACTTTAGAAATGAACGCACCTCGAGGTGCGTTCATTTCTAAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133765
VALIDATED
FBXO31 MISSION shRNA Lentiviral Transduction Particles
F-box protein 31
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000277068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133765.3-566s21c1
Sequence:CCGGTGCGGTTCAAGCCACTGTTTACTCGAGTAAACAGTGGCTTGAACCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133765.3-1533s21c1
Sequence:CCGGCTTTGACGAGATGCTCAGGAACTCGAGTTCCTGAGCATCTCGTCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133765.3-610s21c1
Sequence:CCGGTCGGCTACAGTGGAGTGTATGCTCGAGCATACACTCCACTGTAGCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133765.3-1032s21c1
Sequence:CCGGGCAGACTGTAGAGATTGACCTCTCGAGAGGTCAATCTCTACAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277114    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133765.3-1629s21c1
Sequence:CCGGCACTTTAGAAATGAACGCACACTCGAGTGTGCGTTCATTTCTAAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133765.2-1518s1c1
Sequence:CCGGCTTTGACGAGATGCTCAGGAACTCGAGTTCCTGAGCATCTCGTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133765.2-1017s1c1
Sequence:CCGGGCAGACTGTAGAGATTGACCTCTCGAGAGGTCAATCTCTACAGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191457    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133765.2-1614s1c1
Sequence:CCGGCACTTTAGAAATGAACGCACACTCGAGTGTGCGTTCATTTCTAAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201179    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133765.2-1613s1c1
Sequence:CCGGGCACTTTAGAAATGAACGCACCTCGAGGTGCGTTCATTTCTAAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks