EMAIL THIS PAGE TO A FRIEND

FBXO32

F-box protein 32

84 Gene Product Result for
Synonyms: Fbx32 MAFbx
UniProtKB ID: Q969P5, A4KYM0
Gene ID:
Human(114907) Summary: This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of the ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class and contains an F-box domain. This protein is highly expressed during muscle atrophy, whereas mice deficient in this gene were found to be resistant to atrophy. This protein is thus a potential drug target for the treatment of muscle atrophy. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jun 2011]
Mouse(67731) F-box protein 32
Rat(171043) F-box protein 32
naked mole-rat(101718496) F-box protein 32
sheep(100142676) F-box protein 32
Domestic Rabbit(100356177) F-box protein 32
Zebrafish(393891) F-box protein 32
chicken(420343) F-box protein 32
dog(475091) F-box protein 32
Horse(100057506) F-box protein 32
cow(513776) F-box protein 32
domestic cat(101083398) F-box protein 32
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_058229 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_058229 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_058229 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026346 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026346 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026346 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_058229 Rosetta Predictions human pricing
NM_148177 Rosetta Predictions human pricing
NM_133521 Rosetta Predictions rat pricing
NM_026346 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_058229 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00109115 predicted 1112
2 SASI_Hs01_00109116 predicted 1233
3 SASI_Hs01_00109117 predicted 708
4 SASI_Hs01_00109118 predicted 1062
5 SASI_Hs01_00109120 predicted 1030
6 SASI_Hs01_00109122 predicted 1106
7 SASI_Hs01_00109123 predicted 1032
8 SASI_Hs01_00109124 predicted 763
9 SASI_Hs02_00362139 predicted 778
10 SASI_Hs02_00362140 predicted 1027
11 SASI_Hs01_00109119 predicted 1271
12 SASI_Hs01_00109121 predicted 990
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_148177 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00119267 predicted 793
2 SASI_Hs01_00119268 predicted 915
3 SASI_Hs01_00119269 predicted 389
4 SASI_Hs01_00119270 predicted 741
5 SASI_Hs01_00119272 predicted 712
6 SASI_Hs01_00119274 predicted 790
7 SASI_Hs01_00119275 predicted 712
8 SASI_Hs01_00119276 predicted 440
9 SASI_Hs02_00365571 predicted 453
10 SASI_Hs02_00365572 predicted 710
11 SASI_Hs01_00119271 predicted 948
12 SASI_Hs01_00119273 predicted 673
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133521 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00080419 predicted 356
2 SASI_Rn01_00080421 predicted 635
3 SASI_Rn02_00267699 predicted 251
4 SASI_Rn01_00080422 predicted 222
5 SASI_Rn01_00080423 predicted 809
6 SASI_Rn01_00080424 predicted 822
7 SASI_Rn02_00267700 predicted 785
8 SASI_Rn01_00080426 predicted 570
9 SASI_Rn01_00080427 predicted 392
10 SASI_Rn01_00080428 predicted 501
11 SASI_Rn01_00080420 predicted 480
12 SASI_Rn01_00080425 predicted 471
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026346 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00036617 predicted 1348
2 SASI_Mm01_00036619 predicted 388
3 SASI_Mm01_00036620 predicted 507
4 SASI_Mm01_00036621 predicted 749
5 SASI_Mm01_00036622 predicted 915
6 SASI_Mm01_00036623 predicted 1155
7 SASI_Mm01_00036624 predicted 373
8 SASI_Mm01_00036625 predicted 778
9 SASI_Mm02_00330064 predicted 829
10 SASI_Mm02_00330065 predicted 886
11 SASI_Mm01_00036618 predicted 1301
12 SASI_Mm01_00036626 predicted 1105
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_058229
FBXO32 MISSION shRNA Bacterial Glycerol Stock
F-box protein 32
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000122722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058229.2-1105s1c1
Sequence:CCGGCCAAGGAAAGAGCAGTATGGACTCGAGTCCATACTGCTCTTTCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058229.2-524s1c1
Sequence:CCGGCTGCCATTCTGGATTCCAGAACTCGAGTTCTGGAATCCAGAATGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058229.2-1093s1c1
Sequence:CCGGGTCCGATGTTACCCAAGGAAACTCGAGTTTCCTTGGGTAACATCGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140196    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_058229.2-1126s1c1
Sequence:CCGGGATACCCTTCAGCTCTGCAAACTCGAGTTTGCAGAGCTGAAGGGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000443480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058229.2-271s21c1
Sequence:CCGGGATGAGAAGAGCGGCAGTTTCCTCGAGGAAACTGCCGCTCTTCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058229.2-448s21c1
Sequence:CCGGGTTCACAAAGGAAGTACTAAACTCGAGTTTAGTACTTCCTTTGTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058229.2-1023s21c1
Sequence:CCGGGCAGATCCGCAAACGATTAATCTCGAGATTAATCGTTTGCGGATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058229.2-314s21c1
Sequence:CCGGGCAACAAGGAGGTATACAATACTCGAGTATTGTATACCTCCTTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058229.2-1065s21c1
Sequence:CCGGGGATTGGAAGAAGATGTATTTCTCGAGAAATACATCTTCTTCCAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_058229
FBXO32 MISSION shRNA shRNA Plasmid DNA
F-box protein 32
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000122722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058229.2-1105s1c1
Sequence:CCGGCCAAGGAAAGAGCAGTATGGACTCGAGTCCATACTGCTCTTTCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058229.2-524s1c1
Sequence:CCGGCTGCCATTCTGGATTCCAGAACTCGAGTTCTGGAATCCAGAATGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058229.2-1093s1c1
Sequence:CCGGGTCCGATGTTACCCAAGGAAACTCGAGTTTCCTTGGGTAACATCGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140196    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_058229.2-1126s1c1
Sequence:CCGGGATACCCTTCAGCTCTGCAAACTCGAGTTTGCAGAGCTGAAGGGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000443480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058229.2-271s21c1
Sequence:CCGGGATGAGAAGAGCGGCAGTTTCCTCGAGGAAACTGCCGCTCTTCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058229.2-448s21c1
Sequence:CCGGGTTCACAAAGGAAGTACTAAACTCGAGTTTAGTACTTCCTTTGTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058229.2-1023s21c1
Sequence:CCGGGCAGATCCGCAAACGATTAATCTCGAGATTAATCGTTTGCGGATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058229.2-314s21c1
Sequence:CCGGGCAACAAGGAGGTATACAATACTCGAGTATTGTATACCTCCTTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058229.2-1065s21c1
Sequence:CCGGGGATTGGAAGAAGATGTATTTCTCGAGAAATACATCTTCTTCCAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_058229
FBXO32 MISSION shRNA Lentiviral Transduction Particles
F-box protein 32
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000122722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058229.2-1105s1c1
Sequence:CCGGCCAAGGAAAGAGCAGTATGGACTCGAGTCCATACTGCTCTTTCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058229.2-524s1c1
Sequence:CCGGCTGCCATTCTGGATTCCAGAACTCGAGTTCTGGAATCCAGAATGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058229.2-1093s1c1
Sequence:CCGGGTCCGATGTTACCCAAGGAAACTCGAGTTTCCTTGGGTAACATCGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140196    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_058229.2-1126s1c1
Sequence:CCGGGATACCCTTCAGCTCTGCAAACTCGAGTTTGCAGAGCTGAAGGGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000443480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058229.2-271s21c1
Sequence:CCGGGATGAGAAGAGCGGCAGTTTCCTCGAGGAAACTGCCGCTCTTCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058229.2-448s21c1
Sequence:CCGGGTTCACAAAGGAAGTACTAAACTCGAGTTTAGTACTTCCTTTGTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058229.2-1023s21c1
Sequence:CCGGGCAGATCCGCAAACGATTAATCTCGAGATTAATCGTTTGCGGATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058229.2-314s21c1
Sequence:CCGGGCAACAAGGAGGTATACAATACTCGAGTATTGTATACCTCCTTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058229.2-1065s21c1
Sequence:CCGGGGATTGGAAGAAGATGTATTTCTCGAGAAATACATCTTCTTCCAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026346
FBXO32 MISSION shRNA Bacterial Glycerol Stock
F-box protein 32
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000126920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026346.1-1107s1c1
Sequence:CCGGCGTTTGATCTTGTCTGACAAACTCGAGTTTGTCAGACAAGATCAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026346.1-1133s1c1
Sequence:CCGGGCTGGATTGGAAGAAGATGTACTCGAGTACATCTTCTTCCAATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026346.1-953s1c1
Sequence:CCGGGTGCTTACAACTGAACATCATCTCGAGATGATGTTCAGTTGTAAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026346.1-542s1c1
Sequence:CCGGGCGCCATGGATACTGTACTTTCTCGAGAAAGTACAGTATCCATGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126919    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026346.1-1848s1c1
Sequence:CCGGCCTATGAAGATGCCACACAATCTCGAGATTGTGTGGCATCTTCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026346.2-827s21c1
Sequence:CCGGCTGTGCTGGTGGGCAACATTACTCGAGTAATGTTGCCCACCAGCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026346.2-1159s21c1
Sequence:CCGGTTTAAGCTTGTACGATGTTACCTCGAGGTAACATCGTACAAGCTTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026346.2-1302s21c1
Sequence:CCGGCCCTCAAGACTTTATCAATTTCTCGAGAAATTGATAAAGTCTTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340846    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026346.2-1580s21c1
Sequence:CCGGATTTGCAAGCAAGACTATAAACTCGAGTTTATAGTCTTGCTTGCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026346.2-547s21c1
Sequence:CCGGCGCCATGGATACTGTACTTTGCTCGAGCAAAGTACAGTATCCATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026346
FBXO32 MISSION shRNA shRNA Plasmid DNA
F-box protein 32
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000126920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026346.1-1107s1c1
Sequence:CCGGCGTTTGATCTTGTCTGACAAACTCGAGTTTGTCAGACAAGATCAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026346.1-1133s1c1
Sequence:CCGGGCTGGATTGGAAGAAGATGTACTCGAGTACATCTTCTTCCAATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026346.1-953s1c1
Sequence:CCGGGTGCTTACAACTGAACATCATCTCGAGATGATGTTCAGTTGTAAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026346.1-542s1c1
Sequence:CCGGGCGCCATGGATACTGTACTTTCTCGAGAAAGTACAGTATCCATGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126919    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026346.1-1848s1c1
Sequence:CCGGCCTATGAAGATGCCACACAATCTCGAGATTGTGTGGCATCTTCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026346.2-827s21c1
Sequence:CCGGCTGTGCTGGTGGGCAACATTACTCGAGTAATGTTGCCCACCAGCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026346.2-1159s21c1
Sequence:CCGGTTTAAGCTTGTACGATGTTACCTCGAGGTAACATCGTACAAGCTTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026346.2-1302s21c1
Sequence:CCGGCCCTCAAGACTTTATCAATTTCTCGAGAAATTGATAAAGTCTTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340846    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026346.2-1580s21c1
Sequence:CCGGATTTGCAAGCAAGACTATAAACTCGAGTTTATAGTCTTGCTTGCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026346.2-547s21c1
Sequence:CCGGCGCCATGGATACTGTACTTTGCTCGAGCAAAGTACAGTATCCATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026346
FBXO32 MISSION shRNA Lentiviral Transduction Particles
F-box protein 32
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000126920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026346.1-1107s1c1
Sequence:CCGGCGTTTGATCTTGTCTGACAAACTCGAGTTTGTCAGACAAGATCAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026346.1-1133s1c1
Sequence:CCGGGCTGGATTGGAAGAAGATGTACTCGAGTACATCTTCTTCCAATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026346.1-953s1c1
Sequence:CCGGGTGCTTACAACTGAACATCATCTCGAGATGATGTTCAGTTGTAAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026346.1-542s1c1
Sequence:CCGGGCGCCATGGATACTGTACTTTCTCGAGAAAGTACAGTATCCATGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126919    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026346.1-1848s1c1
Sequence:CCGGCCTATGAAGATGCCACACAATCTCGAGATTGTGTGGCATCTTCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026346.2-827s21c1
Sequence:CCGGCTGTGCTGGTGGGCAACATTACTCGAGTAATGTTGCCCACCAGCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026346.2-1159s21c1
Sequence:CCGGTTTAAGCTTGTACGATGTTACCTCGAGGTAACATCGTACAAGCTTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026346.2-1302s21c1
Sequence:CCGGCCCTCAAGACTTTATCAATTTCTCGAGAAATTGATAAAGTCTTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340846    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026346.2-1580s21c1
Sequence:CCGGATTTGCAAGCAAGACTATAAACTCGAGTTTATAGTCTTGCTTGCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026346.2-547s21c1
Sequence:CCGGCGCCATGGATACTGTACTTTGCTCGAGCAAAGTACAGTATCCATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks