EMAIL THIS PAGE TO A FRIEND

FBXO33

F-box protein 33

164 Gene Product Result for
Synonyms: BMND12 Fbx33 c14_5247
UniProtKB ID: Q7Z6M2, Q6PIR2, Q86TR2, Q86YE0
Gene ID:
Human(254170) Summary: This locus represents an member of the F-box gene family. The encoded protein contains an F-box motif and a domain that might form a structure similar to a leucine-rich repeat found in placental RNAse inhibitor. This locus may be associated with copy number variation of UGT2B17 (GeneID 7367), which has been associated with susceptibility to osteoporosis.[provided by RefSeq, Sep 2010]
Mouse(70611) F-box protein 33
Rat(314157) F-box protein 33
chicken(428887) F-box protein 33
cow(539998) F-box protein 33
Horse(100061051) F-box protein 33
domestic cat(101083773) F-box protein 33
dog(490663) F-box protein 33
sheep(101106799) F-box protein 33
Domestic Rabbit(100340778) F-box protein 33
naked mole-rat(101717837) F-box protein 33
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_203301 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_203301 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_203301 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_127032 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_127032 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_127032 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_203301 Rosetta Predictions human pricing
NM_001108023 Rosetta Predictions rat pricing
NM_001033156 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203301 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00194583 predicted 1650
2 SASI_Hs01_00194584 predicted 1130
3 SASI_Hs01_00194585 predicted 1121
4 SASI_Hs02_00373231 predicted 898
5 SASI_Hs01_00194586 predicted 1051
6 SASI_Hs01_00194587 predicted 1146
7 SASI_Hs02_00373232 predicted 1409
8 SASI_Hs01_00194588 predicted 1568
9 SASI_Hs01_00194590 predicted 1217
10 SASI_Hs01_00194591 predicted 1210
11 SASI_Hs01_00194589 predicted 1024
12 SASI_Hs01_00194592 predicted 1436
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108023 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00234605 predicted 1092
2 SASI_Rn02_00234606 predicted 948
3 SASI_Rn02_00234607 predicted 492
4 SASI_Rn02_00234608 predicted 1300
5 SASI_Rn02_00234609 predicted 599
6 SASI_Rn02_00234610 predicted 930
7 SASI_Rn02_00234611 predicted 640
8 SASI_Rn02_00234612 predicted 610
9 SASI_Rn02_00234613 predicted 1508
10 SASI_Rn02_00234614 predicted 1138
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033156 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00030051 predicted 1207
2 SASI_Mm01_00030052 predicted 916
3 SASI_Mm02_00288233 predicted 744
4 SASI_Mm01_00030053 predicted 1049
5 SASI_Mm02_00288234 predicted 1171
6 SASI_Mm02_00288235 predicted 933
7 SASI_Mm01_00030054 predicted 1249
8 SASI_Mm01_00030055 predicted 1278
9 SASI_Mm01_00030056 predicted 1415
10 SASI_Mm02_00288236 predicted 1176
11 SASI_Mm01_00030050 predicted 820
12 SASI_Mm01_00030057 predicted 946
13 SASI_Mm01_00030058 predicted 861
14 SASI_Mm01_00030059 predicted 1158
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_203301
FBXO33 MISSION shRNA Bacterial Glycerol Stock
F-box protein 33
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000427833    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_203301.2-2241s21c1
Sequence:CCGGAGGATATACAGCCGAAGATTGCTCGAGCAATCTTCGGCTGTATATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118497    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_203301.1-2424s1c1
Sequence:CCGGGCCAAGACTTTAACTTTCATTCTCGAGAATGAAAGTTAAAGTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203301.1-1149s1c1
Sequence:CCGGGCAGTTGAACTGGAGCGATTTCTCGAGAAATCGCTCCAGTTCAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203301.1-1317s1c1
Sequence:CCGGCCAAATGATGAGCATTGGAAACTCGAGTTTCCAATGCTCATCATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203301.1-1585s1c1
Sequence:CCGGGAAATGAAGATCCGTTGGTTTCTCGAGAAACCAACGGATCTTCATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203301.1-1021s1c1
Sequence:CCGGCCTGTGGGTTTATGCTGGAAACTCGAGTTTCCAGCATAAACCCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_203301
FBXO33 MISSION shRNA shRNA Plasmid DNA
F-box protein 33
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000427833    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_203301.2-2241s21c1
Sequence:CCGGAGGATATACAGCCGAAGATTGCTCGAGCAATCTTCGGCTGTATATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118497    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_203301.1-2424s1c1
Sequence:CCGGGCCAAGACTTTAACTTTCATTCTCGAGAATGAAAGTTAAAGTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203301.1-1149s1c1
Sequence:CCGGGCAGTTGAACTGGAGCGATTTCTCGAGAAATCGCTCCAGTTCAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203301.1-1317s1c1
Sequence:CCGGCCAAATGATGAGCATTGGAAACTCGAGTTTCCAATGCTCATCATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203301.1-1585s1c1
Sequence:CCGGGAAATGAAGATCCGTTGGTTTCTCGAGAAACCAACGGATCTTCATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203301.1-1021s1c1
Sequence:CCGGCCTGTGGGTTTATGCTGGAAACTCGAGTTTCCAGCATAAACCCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_203301
FBXO33 MISSION shRNA Lentiviral Transduction Particles
F-box protein 33
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000427833    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_203301.2-2241s21c1
Sequence:CCGGAGGATATACAGCCGAAGATTGCTCGAGCAATCTTCGGCTGTATATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118497    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_203301.1-2424s1c1
Sequence:CCGGGCCAAGACTTTAACTTTCATTCTCGAGAATGAAAGTTAAAGTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203301.1-1149s1c1
Sequence:CCGGGCAGTTGAACTGGAGCGATTTCTCGAGAAATCGCTCCAGTTCAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203301.1-1317s1c1
Sequence:CCGGCCAAATGATGAGCATTGGAAACTCGAGTTTCCAATGCTCATCATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203301.1-1585s1c1
Sequence:CCGGGAAATGAAGATCCGTTGGTTTCTCGAGAAACCAACGGATCTTCATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203301.1-1021s1c1
Sequence:CCGGCCTGTGGGTTTATGCTGGAAACTCGAGTTTCCAGCATAAACCCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_127032
VALIDATED
FBXO33 MISSION shRNA Bacterial Glycerol Stock
F-box protein 33
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000087293    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:XM_127032.4-2447s1c1
Sequence:CCGGGCCAATGATTATCTGAGGTTACTCGAGTAACCTCAGATAATCATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127032.4-1861s1c1
Sequence:CCGGCGAAACGAAGATCCATTGGTTCTCGAGAACCAATGGATCTTCGTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: B16-F0
TRC Version: 1 Clone ID:XM_127032.4-1441s1c1
Sequence:CCGGCGGTTTGTAAATCTACGCTCACTCGAGTGAGCGTAGATTTACAAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: B16-F0
TRC Version: 1 Clone ID:XM_127032.4-1572s1c1
Sequence:CCGGGCTCAAGTCATTAGACAACATCTCGAGATGTTGTCTAATGACTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:XM_127032.4-1377s1c1
Sequence:CCGGCCTGAGTTTACTGGACAACAACTCGAGTTGTTGTCCAGTAAACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_127032
VALIDATED
FBXO33 MISSION shRNA shRNA Plasmid DNA
F-box protein 33
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000087293    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:XM_127032.4-2447s1c1
Sequence:CCGGGCCAATGATTATCTGAGGTTACTCGAGTAACCTCAGATAATCATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127032.4-1861s1c1
Sequence:CCGGCGAAACGAAGATCCATTGGTTCTCGAGAACCAATGGATCTTCGTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: B16-F0
TRC Version: 1 Clone ID:XM_127032.4-1441s1c1
Sequence:CCGGCGGTTTGTAAATCTACGCTCACTCGAGTGAGCGTAGATTTACAAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: B16-F0
TRC Version: 1 Clone ID:XM_127032.4-1572s1c1
Sequence:CCGGGCTCAAGTCATTAGACAACATCTCGAGATGTTGTCTAATGACTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:XM_127032.4-1377s1c1
Sequence:CCGGCCTGAGTTTACTGGACAACAACTCGAGTTGTTGTCCAGTAAACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_127032
VALIDATED
FBXO33 MISSION shRNA Lentiviral Transduction Particles
F-box protein 33
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000087293    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:XM_127032.4-2447s1c1
Sequence:CCGGGCCAATGATTATCTGAGGTTACTCGAGTAACCTCAGATAATCATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127032.4-1861s1c1
Sequence:CCGGCGAAACGAAGATCCATTGGTTCTCGAGAACCAATGGATCTTCGTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: B16-F0
TRC Version: 1 Clone ID:XM_127032.4-1441s1c1
Sequence:CCGGCGGTTTGTAAATCTACGCTCACTCGAGTGAGCGTAGATTTACAAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: B16-F0
TRC Version: 1 Clone ID:XM_127032.4-1572s1c1
Sequence:CCGGGCTCAAGTCATTAGACAACATCTCGAGATGTTGTCTAATGACTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:XM_127032.4-1377s1c1
Sequence:CCGGCCTGAGTTTACTGGACAACAACTCGAGTTGTTGTCCAGTAAACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks